ID: 984119928

View in Genome Browser
Species Human (GRCh38)
Location 4:175729579-175729601
Sequence AATAACTAAAAGAGTATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4231
Summary {0: 12, 1: 486, 2: 1010, 3: 1275, 4: 1448}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984119928 Original CRISPR AATAACTAAAAGAGTATAAG TGG Intronic
Too many off-targets to display for this crispr