ID: 984122107

View in Genome Browser
Species Human (GRCh38)
Location 4:175758346-175758368
Sequence CAGTAGCATTTTTACGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984122106_984122107 10 Left 984122106 4:175758313-175758335 CCATAAGAAAATCAAGGTATTTT 0: 1
1: 0
2: 6
3: 109
4: 888
Right 984122107 4:175758346-175758368 CAGTAGCATTTTTACGAAAATGG 0: 1
1: 0
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984122107 Original CRISPR CAGTAGCATTTTTACGAAAA TGG Intronic
902557868 1:17257652-17257674 AAGCAGCTTTTTTATGAAAAGGG - Intronic
907916939 1:58879470-58879492 CAGTAGAATTTTTTCAAAATTGG - Intergenic
910210864 1:84791453-84791475 CAATAGCATTTTTTCCATAAAGG - Intergenic
919601723 1:199631565-199631587 CAGTATGATTTTTAAGAATAAGG + Intergenic
920158256 1:203974100-203974122 CAGTAACACTGTTACAAAAAAGG + Intergenic
1063956994 10:11276407-11276429 CAGCAGCATCTTTACGAATATGG + Intronic
1066362716 10:34746824-34746846 CTGTGACATTTTTACTAAAAGGG + Intronic
1068407834 10:56615073-56615095 CTGTAACATATTTAGGAAAATGG + Intergenic
1070952833 10:80444609-80444631 AAGTAGCATTTGTAGGAAATGGG + Intergenic
1071683578 10:87732210-87732232 CATTAACATTTTTAGCAAAAAGG + Intronic
1071709714 10:88038244-88038266 CAGTAGAATTTTTTGGTAAAGGG + Intergenic
1072986044 10:100141636-100141658 CAGGAGGATTTTTATGTAAAGGG + Intergenic
1075304146 10:121352836-121352858 CTGTATCATATTTACTAAAATGG + Intergenic
1079918755 11:26404769-26404791 CAATAGCAGTTTTACAGAAAAGG + Intronic
1080332469 11:31154959-31154981 CAGAAGCATTTTTAGGCAAAGGG + Intronic
1082129226 11:48467875-48467897 CAATAACATTTTTCCAAAAAAGG - Intergenic
1082248201 11:49949505-49949527 CAATAACATTTTTCCAAAAATGG + Intergenic
1082562760 11:54638767-54638789 CAATAACATTTTTCCAAAAAAGG - Intergenic
1083063155 11:59895806-59895828 AAGTAGCATTTTTTCTAAACAGG - Intergenic
1084997568 11:72996954-72996976 AAGTGGCATTTTTACGAGACTGG + Intronic
1085838416 11:79981564-79981586 GGGAAGCATTTTTACGTAAAGGG + Intergenic
1086733581 11:90279012-90279034 CAATAGTATTTTTACAGAAACGG - Intergenic
1087209651 11:95434022-95434044 CACTTCCATTTTTACAAAAAAGG + Intergenic
1092347085 12:7724321-7724343 CAGTTCCATTTTTATGACAAAGG + Intergenic
1092935649 12:13361539-13361561 AAGTAGCATTTGTAGGAGAAAGG - Intergenic
1093787401 12:23208376-23208398 CAATAGCATTTTGAAGCAAAGGG - Intergenic
1093930079 12:24947297-24947319 GAGTAGCATGTGTACAAAAATGG - Intronic
1095602660 12:44031593-44031615 CAGCAGCATTTTAAGCAAAAAGG - Intronic
1098931434 12:76419361-76419383 CAGTAGCCTTTTTAAAAGAAAGG - Intronic
1099784784 12:87247896-87247918 CAGTAGGATTTTTTGGCAAAAGG - Intergenic
1100169389 12:91956870-91956892 CAATAGCATTTTTTCCTAAAAGG - Intergenic
1102766516 12:115438404-115438426 CAGTAGCAGGTTTAGGTAAAGGG + Intergenic
1105305401 13:19165265-19165287 CACTAGCATTTTTATGACACTGG - Intergenic
1106302669 13:28483766-28483788 CAGTAACTTGTTTAAGAAAAAGG + Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107656675 13:42598646-42598668 CAGTAGCATTTGAAGGATAAGGG + Intronic
1108353151 13:49605732-49605754 CAGTAGCTTTTTAAAGAATATGG - Intergenic
1108619606 13:52168588-52168610 CAATAGCAATTTTACCAAAGAGG + Intergenic
1108987313 13:56609090-56609112 CAGCACCATTTTTTTGAAAAGGG + Intergenic
1109442196 13:62389703-62389725 CAATAACATTTTTAAGAGAATGG - Intergenic
1109869598 13:68316388-68316410 CAGTAGCACTTTTTCAAAATTGG + Intergenic
1110096525 13:71529859-71529881 AAATAGTATTTTTAGGAAAATGG + Intronic
1110397033 13:75042339-75042361 CAGTATCATCTTTGAGAAAATGG + Intergenic
1111192393 13:84826348-84826370 CAGTTTCATTCTTACGAATATGG + Intergenic
1112397093 13:99043232-99043254 CAGTAGGACTTTTAGGCAAAAGG + Intronic
1114809177 14:25875779-25875801 CAGCATCATTATTACAAAAATGG - Intergenic
1115042086 14:28943364-28943386 AAGTAACATTTTTATGGAAATGG + Intergenic
1120370987 14:83635616-83635638 CATCAGCATTTTAATGAAAAAGG + Intergenic
1121133747 14:91475017-91475039 CTGTGGTATTTTTACGAAATAGG - Intronic
1122102408 14:99423874-99423896 AAGTATGATTTTTATGAAAAAGG - Intronic
1122192333 14:100055457-100055479 CAGTAACATTTTTCCAAAGAAGG + Intronic
1125820354 15:42624901-42624923 TAGTAGCAATTTTTCTAAAAAGG + Intronic
1126293790 15:47113989-47114011 CAGTTGCATTATTACCAAAATGG - Intergenic
1129014887 15:72458029-72458051 CAGTAGCATTTTTTTAAACAGGG + Intergenic
1130368965 15:83266935-83266957 CAGTAGGATTTTTAGGCGAACGG + Exonic
1132217383 15:100075376-100075398 CAGTATCATATTTCAGAAAATGG - Intronic
1134670447 16:16050960-16050982 TAGTAGCACTTTTACAAAAGTGG - Intronic
1137900736 16:52265853-52265875 CAGTTGCATTTTAACGATATAGG - Intergenic
1147860988 17:43523134-43523156 AAGTAGCATTTTTAAAAAATTGG + Intronic
1149669189 17:58390768-58390790 AAGTAGCAATTTAATGAAAAAGG + Intronic
1150509228 17:65731638-65731660 CAGTAGAATTTCTTTGAAAATGG + Intronic
1151125101 17:71836373-71836395 CAGTAGAATTTATAAGGAAATGG - Intergenic
1152753750 17:82078373-82078395 GAGCAGCATTTTTACCAAATTGG + Exonic
1153157535 18:2166666-2166688 AAGTGGCATTTTTGAGAAAATGG + Intergenic
1158164754 18:54528032-54528054 CAGAAACAGTTTTAAGAAAAAGG - Intergenic
1159967910 18:74614798-74614820 CAGTTGCATTTCTGAGAAAAAGG + Intronic
1160332333 18:78005963-78005985 CAGTAGCACTTTCAATAAAACGG - Intergenic
1161553468 19:4927622-4927644 CAGGAGCATCCTTAGGAAAAGGG - Intronic
925025840 2:606449-606471 CAGTATCCTTGTTTCGAAAATGG + Intergenic
926807471 2:16724337-16724359 CAGTAATCTTTTTAAGAAAAAGG + Intergenic
927344939 2:22027272-22027294 CAGTAACATTTATAGGAAGAAGG + Intergenic
929223302 2:39487407-39487429 CCTTAGAATCTTTACGAAAAAGG - Intergenic
933985377 2:87586739-87586761 CAGGAGCATTATTACGGAGAGGG + Intergenic
936308464 2:111364070-111364092 CAGGAGCATTATTACGGAGAGGG - Intergenic
936706785 2:115084891-115084913 CATTAGCATTTCTAGGAAAAGGG + Intronic
941901215 2:170680498-170680520 CATTAGCATTTATAGAAAAATGG + Intergenic
944827576 2:203500943-203500965 CAGTAGCTTTCTCACAAAAATGG + Intronic
945605170 2:211920097-211920119 CAGTTGCATTTTTAAAACAATGG - Intronic
946258004 2:218461123-218461145 CAGGAGCATTTGTACATAAATGG + Intronic
1179020291 21:37634514-37634536 CAGTATCATTTTTAACAAATTGG + Intronic
949338974 3:3008220-3008242 CATTAGCATTTTTCCTAAACTGG - Intronic
950243763 3:11396032-11396054 CACTAGCATGTTTACACAAAAGG + Intronic
950923677 3:16718996-16719018 CAGTAGGATTTTTAAACAAAGGG + Intergenic
952505737 3:34005450-34005472 CAGTAGCATTTTTACTTGATGGG + Intergenic
952665205 3:35895651-35895673 CAGTAGTATTTTGATGAGAAAGG - Intergenic
954127548 3:48540370-48540392 CAGTGGCATTGCTAAGAAAAGGG + Intronic
955203622 3:56875667-56875689 CAGTAGCATTTCAAAAAAAAGGG - Intronic
956364849 3:68489774-68489796 TAATAACATTTTTAAGAAAATGG - Intronic
956988984 3:74741032-74741054 CAGTAGGATTTTTAAAGAAATGG - Intergenic
957427522 3:80058814-80058836 CAGTAGAAGTTTTAAGAAAGTGG + Intergenic
957711253 3:83861737-83861759 CATTACCATTTTTAAGAAAGTGG - Intergenic
960826316 3:121788918-121788940 CAGTAGAATTGTTAATAAAAAGG + Intronic
962748388 3:138414521-138414543 GAGTGGCATTTTTAGGAAAGAGG - Intergenic
965313765 3:167164660-167164682 AAGTAGCATTTTTACCTTAAAGG - Intergenic
965832501 3:172808712-172808734 CAGTACCATTGTACCGAAAAGGG - Intronic
967123396 3:186403829-186403851 CTGTCCCATTTTTACGCAAAAGG + Intergenic
969719664 4:8886511-8886533 GATTAGCATTTTTAGGAACAAGG - Intergenic
970055918 4:11971827-11971849 CTGTAGCATATTTACTAAAGAGG - Intergenic
973340823 4:49002463-49002485 CAGAAGTATTTTTACATAAATGG - Intronic
974494722 4:62611833-62611855 CTGTGGCATTTTTATTAAAAAGG - Intergenic
977294453 4:95195078-95195100 CAGTGGCATTTTGAAGATAATGG - Intronic
979979245 4:127234557-127234579 CAGGAGGATTTTTATTAAAATGG - Intergenic
980097188 4:128503572-128503594 CAGTGGCATTCTTGCCAAAATGG - Intergenic
980562581 4:134497361-134497383 CAGTAGATTTTTTAAAAAAATGG + Intergenic
981696155 4:147561278-147561300 CTGTAGGCTTTTTAAGAAAATGG + Intergenic
984122107 4:175758346-175758368 CAGTAGCATTTTTACGAAAATGG + Intronic
984251464 4:177340870-177340892 AAGTAGAATTTATACCAAAATGG + Intronic
986845375 5:11745969-11745991 CACTAGCATTTTAAATAAAATGG - Intronic
988301061 5:29427662-29427684 AAGTAACATTTTTGCCAAAAAGG + Intergenic
992257096 5:74932051-74932073 AAGGAGCATTTTAACAAAAACGG + Intergenic
992433920 5:76736954-76736976 AAATAGCATTTTTAAGGAAATGG + Intergenic
994798203 5:104333693-104333715 CAGTAGAATTTTTAAGAAATTGG - Intergenic
996567392 5:124893837-124893859 TAATAGCAGTTTTATGAAAAAGG - Intergenic
996823225 5:127653593-127653615 AAGAATCATTTTTACCAAAAAGG + Intronic
997619897 5:135280640-135280662 CAGTACTATTTTTATGTAAATGG - Intronic
999993740 5:157071978-157072000 TTGTAGCATTTTTGCAAAAATGG - Intergenic
1000691628 5:164328201-164328223 CAGTAACTTTTTTCCAAAAAGGG - Intergenic
1001145048 5:169176634-169176656 CAGTAACATTTTTCTGTAAAGGG + Intronic
1001893487 5:175359268-175359290 AAGCAGCATTTATAAGAAAACGG + Intergenic
1004728415 6:18333612-18333634 CAGTATCCTTTTTAAGAAAATGG + Intergenic
1007918006 6:45579093-45579115 CACTAGCATTTCTACAGAAATGG + Intronic
1008217456 6:48810966-48810988 CACTAGCATTTTTATAATAAAGG + Intergenic
1009004305 6:57763505-57763527 AAGTAACATTTTTGCCAAAAAGG + Intergenic
1010215429 6:73397000-73397022 CAGTAGTGTTATTATGAAAATGG + Intronic
1012187321 6:96235076-96235098 CAGAAGCATCTTTAGTAAAATGG + Intergenic
1016668977 6:146678628-146678650 AAGTAGCATATTTATGACAACGG + Intronic
1017045386 6:150342623-150342645 CAATGTCATTTTTAGGAAAAGGG - Intergenic
1017085051 6:150705890-150705912 CAGCAGCATTTTTCCTAGAAAGG - Intronic
1018494265 6:164332550-164332572 CAGTAGCATTTTTAAGTATTAGG - Intergenic
1020415147 7:7936925-7936947 AAGTAGCAATTTTGCTAAAAAGG - Intronic
1022105380 7:27192890-27192912 CAGGAGCATTTTCTCTAAAAGGG - Intergenic
1027956733 7:84887934-84887956 GAGTAGGATTTTTAAGCAAAAGG - Intergenic
1028822394 7:95227677-95227699 CAGTAACATTTTTCAGTAAAGGG - Intronic
1028883394 7:95905462-95905484 CAGTGGCCTTTTTAAGAAAAAGG - Intronic
1028942111 7:96533189-96533211 CAGTTTCATTTTGATGAAAAAGG - Intronic
1030017664 7:105240970-105240992 CAGTATCATTTTTACAAAATTGG + Intronic
1031141362 7:117947067-117947089 CAGTAGCATTTTTAGGATCCAGG + Intergenic
1031289807 7:119919398-119919420 CAGTAACATTTTTAAGATCATGG - Intergenic
1032707088 7:134430695-134430717 CAGTAGCATATTTACAGATAGGG + Intergenic
1035942461 8:3917620-3917642 AATAAGCATTTTTAAGAAAAAGG - Intronic
1037093231 8:14948620-14948642 CAGGAGCACTTTTATTAAAAAGG - Intronic
1038288868 8:26230775-26230797 CAGTAGCATCTTTTGGAGAAGGG + Intergenic
1040061652 8:43108569-43108591 CAGCAGCATTTTAAACAAAAAGG + Intronic
1042794067 8:72640874-72640896 CAGAACCAGTCTTACGAAAATGG + Intronic
1043029227 8:75110770-75110792 CAGTGGCATTTTTCAGAAATAGG - Intergenic
1046001884 8:108431611-108431633 CAGTAAAATTTTAAGGAAAAGGG - Intronic
1047625874 8:126655611-126655633 CGGTAGCATTTAAAAGAAAAAGG + Intergenic
1048596146 8:135868488-135868510 CAGAAGCAGGTTTAAGAAAAAGG + Intergenic
1052411844 9:28131334-28131356 CAGTAGGATTTTAAGGAAGAAGG - Intronic
1052489263 9:29143287-29143309 CAATGGCATTTTTGCAAAAATGG + Intergenic
1052505350 9:29346559-29346581 CAGTATCATCTTTAATAAAATGG + Intergenic
1052845424 9:33331710-33331732 CAGGATAATTTTTACGAAGAGGG + Intronic
1052870891 9:33505676-33505698 CAATAGCAATTTTACCAAAGAGG + Intergenic
1053100512 9:35367921-35367943 CAGAAGCCTTTGTAGGAAAAAGG - Intronic
1055771089 9:79717793-79717815 GAGTAGCATCTTTTCCAAAATGG + Intronic
1057687628 9:97249685-97249707 CAATAGCAATTTTACCAAAGAGG - Intergenic
1057822841 9:98345993-98346015 CATTAGCATTTTTAACAATAAGG - Intronic
1057865762 9:98679498-98679520 AAGTAGAATTTCTATGAAAAGGG + Intronic
1059158346 9:112010247-112010269 CATTAGCATTTTTAGCAATAAGG + Intergenic
1185929163 X:4182706-4182728 CTCTGGCATTTTTAAGAAAAAGG - Intergenic
1188299565 X:28490996-28491018 CAGTAGCATTTATAAGAAATAGG - Intergenic
1189263488 X:39695069-39695091 CATTAGCATTTTTAGCAATAAGG - Intergenic
1196129278 X:112136654-112136676 CAGTAGCATTTTTACAGAACTGG + Intergenic
1198803438 X:140470668-140470690 CATCAGCATTTTAACCAAAAGGG - Intergenic
1199437303 X:147827289-147827311 CAGCAGCATATATACTAAAATGG + Intergenic