ID: 984125854

View in Genome Browser
Species Human (GRCh38)
Location 4:175809319-175809341
Sequence AGATGATGCTAGGTTTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984125849_984125854 22 Left 984125849 4:175809274-175809296 CCTTGTTGCCATGATTTTGTGAC 0: 1
1: 0
2: 0
3: 4
4: 219
Right 984125854 4:175809319-175809341 AGATGATGCTAGGTTTATTATGG 0: 1
1: 0
2: 0
3: 12
4: 149
984125851_984125854 14 Left 984125851 4:175809282-175809304 CCATGATTTTGTGACAATGGCTC 0: 1
1: 0
2: 2
3: 17
4: 112
Right 984125854 4:175809319-175809341 AGATGATGCTAGGTTTATTATGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984125854 Original CRISPR AGATGATGCTAGGTTTATTA TGG Intronic
907167895 1:52431127-52431149 AGATGATGCTGGGATCATTTAGG + Exonic
910455327 1:87391657-87391679 AGATGATCCTAGACTTATGATGG - Intergenic
912038449 1:105352224-105352246 AGATGATCTTATGTTTATTGGGG - Intergenic
912243747 1:107939313-107939335 AGATGGTCCTAGGCTTACTATGG + Intronic
913304945 1:117418851-117418873 AGATGATGATGTGTTAATTAGGG + Intronic
913383757 1:118237790-118237812 AGGTGATGCTTTGTTTATGAAGG - Intergenic
915854994 1:159373704-159373726 TGATGAAGCTAGTTTTATTAGGG - Intergenic
917766441 1:178223740-178223762 AGATGATGGTAGATTCATTTAGG + Intronic
918017613 1:180651678-180651700 AGATAATGCCTAGTTTATTAAGG + Intronic
919108256 1:193182146-193182168 AGACGGTGCAAGGTTGATTATGG + Intronic
921000769 1:211040429-211040451 ATCTGATGATGGGTTTATTAGGG + Intronic
1068824001 10:61412374-61412396 AGAGGATGCTATGTTTAAAATGG + Intronic
1069176128 10:65290428-65290450 AAATGATGATAGCTTTATAATGG - Intergenic
1070165311 10:73893267-73893289 AAATGATGCTAGGTGGATGACGG + Intergenic
1071704656 10:87984173-87984195 AGATGATGGAAGGTTTTGTATGG - Intergenic
1072441580 10:95460843-95460865 AGATGATGATGGTTTTATTAGGG - Intronic
1073665293 10:105525343-105525365 AGAAGATACAAGGTTTCTTATGG - Intergenic
1074347753 10:112704797-112704819 AAATGATGCTAGGTCCAGTAGGG + Intronic
1077701563 11:4446808-4446830 AGATGATGATATGTCAATTATGG + Intergenic
1079414177 11:20217568-20217590 AGATGATGCTGGCTCTAATATGG - Intergenic
1081056542 11:38416393-38416415 AAATAATACAAGGTTTATTAAGG - Intergenic
1081242639 11:40725789-40725811 TGCTGATGCTAGGTTTCTGAAGG - Intronic
1081260902 11:40959328-40959350 AGAATATTCCAGGTTTATTACGG + Intronic
1081338657 11:41900594-41900616 AGGTGATGGAACGTTTATTATGG - Intergenic
1084585655 11:70060436-70060458 AGAAGATGCTATATGTATTAGGG + Intergenic
1085924424 11:80998568-80998590 AGATGATGGTAGGTCAATGAGGG - Intergenic
1087832751 11:102837461-102837483 AGATCATGTTAGGTTTAATGTGG + Intronic
1092929089 12:13298340-13298362 AGATCATGCAAGGTTTGTTAAGG - Intergenic
1095165793 12:38970119-38970141 AGATGATGCTATTTTTATTCTGG - Intergenic
1095555751 12:43501761-43501783 AGAAGATACTATTTTTATTATGG - Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1096821497 12:54239210-54239232 AGATGATACTGGGGTTATTTCGG + Exonic
1097456039 12:59799685-59799707 ATGTGCTGCTAGATTTATTAAGG - Intergenic
1097482461 12:60147231-60147253 AGAAGATCCTAGGTTTCTGAAGG + Intergenic
1100690477 12:97033977-97033999 AAATAATGCTAGCTTTATTAGGG + Intergenic
1102879307 12:116472072-116472094 AGATGGGGCTATGTTCATTAAGG + Intergenic
1103312090 12:120018587-120018609 AGATGAACCTGGGTTTATTTTGG + Intronic
1107367274 13:39696078-39696100 AGATGATAATAGGTTTTTTTAGG + Intronic
1107874990 13:44782587-44782609 AGAGGATTGTAGGTTTATTAGGG - Intergenic
1109871057 13:68334293-68334315 AGATGATCCTTGGCTTATAATGG + Intergenic
1110472463 13:75875387-75875409 TAATGAGGCTAGGTTTACTAAGG + Intronic
1115086411 14:29520854-29520876 AGATGATGTTATATTTAATAGGG - Intergenic
1116224833 14:42137109-42137131 AGATGCTCCTTGATTTATTATGG + Intergenic
1117139551 14:52774437-52774459 AGGTGAAGCTATGTTTGTTATGG - Exonic
1119304248 14:73594612-73594634 AGATGCTGCTAGCTTTAATCTGG - Intronic
1202849023 14_GL000225v1_random:4552-4574 AGATGATGTTAGTTTTCTCAAGG - Intergenic
1123929594 15:25157846-25157868 AGATGATCCTTGATTTATGAAGG - Intergenic
1126492496 15:49253826-49253848 TGATGATGCTTGGTGTTTTAAGG - Intronic
1127639255 15:60900107-60900129 AAATGATGCCAGTTGTATTATGG - Intronic
1128626296 15:69208620-69208642 AGCTGATGCCAAGATTATTATGG - Intronic
1130005144 15:80088955-80088977 AGATTATGGTGGGTCTATTATGG - Intronic
1137518126 16:49167971-49167993 AGATGATGCCATGTTTCTTCAGG - Intergenic
1138954338 16:61952700-61952722 AAATTATGCAATGTTTATTAGGG + Intronic
1140314180 16:73878355-73878377 AGAAGATGCAAAGTTTGTTAGGG + Intergenic
1146592992 17:34144930-34144952 AGATAACTCTAGGTTTAGTATGG - Intronic
1150660724 17:67074724-67074746 AGATGTTGCTATGTTTAATTAGG + Exonic
1156982208 18:43303506-43303528 AGATGATGCAACGTGTATAAAGG - Intergenic
1158927948 18:62289668-62289690 AGAAGATTCTTAGTTTATTAAGG - Intronic
1158966643 18:62627918-62627940 AGATGATGTTATGTATATGAAGG - Intergenic
1160052424 18:75447394-75447416 AGATGAGAGCAGGTTTATTAGGG + Intergenic
1161031090 19:2058068-2058090 AGAAGAAGCTAGGTTTACTGGGG - Intergenic
1161712441 19:5856702-5856724 GGAAGATGCTATGTGTATTAGGG - Intergenic
1163209976 19:15833093-15833115 GGAAGATGCTATGTGTATTAGGG - Intergenic
1168641768 19:58035410-58035432 AGGAGATGCTAAGTTTATCAGGG - Intronic
926698572 2:15787542-15787564 AGATGATGCTAAGATTCTAAGGG + Intergenic
928602030 2:32913027-32913049 AGATGCTCCTCGGTTTATGATGG + Intergenic
928628512 2:33166375-33166397 TGATGATACTTGGTTTATTTAGG + Intronic
929135594 2:38620844-38620866 AGATAATTCTAATTTTATTAGGG - Intergenic
931609596 2:64084466-64084488 AGATAATGCTGGGTTTTTAATGG - Intergenic
934227634 2:90147915-90147937 GGAAGATGCTATGTGTATTAGGG + Intergenic
935832883 2:107018912-107018934 ACATGATGCTATTTTAATTATGG - Intergenic
939462674 2:142516884-142516906 AGATGCTTCTAGATTTATGATGG - Intergenic
942074357 2:172343041-172343063 AGAAGATGCTGGGTTTTTTTTGG + Intergenic
942074980 2:172349490-172349512 AGATGACACTTGGTTTTTTAAGG + Intergenic
944047315 2:195427937-195427959 AGATAATGCAAGGGTTATTCAGG + Intergenic
944054630 2:195510547-195510569 AGATGATGGTTGCTTTGTTAGGG - Intergenic
944151891 2:196568524-196568546 AGATGCTTCTGGATTTATTATGG - Intronic
944218212 2:197276756-197276778 AGAGGATGCTGGGTTTGATAAGG + Intronic
944290602 2:198000146-198000168 AGATGATGCCAGGGTAGTTAAGG + Intronic
945098811 2:206244930-206244952 AAATGATGCTATGTTTAGTAGGG - Intergenic
945824116 2:214699312-214699334 ATATGATGCCAGGTGTATTTTGG + Intergenic
946288342 2:218722773-218722795 AGATGATGGTAGCTTGACTAAGG + Intronic
1173141019 20:40482906-40482928 AGATGAAGCTACATTTCTTAAGG + Intergenic
1173876488 20:46375535-46375557 AGATCATGCTAGATTTTCTAGGG + Intronic
1174871800 20:54189948-54189970 AAAAGATGCTAGTTTTATTTTGG - Intergenic
1177341300 21:19804622-19804644 AGATAAAGGCAGGTTTATTATGG - Intergenic
1178067959 21:28927230-28927252 AAATGAAGCTAGGCTTCTTAAGG + Intergenic
950998339 3:17528968-17528990 AGATGATGCTAGCTTAAATTAGG - Intronic
951022882 3:17799704-17799726 AGATGATGCTATCTTGAATAGGG - Intronic
953583046 3:44174077-44174099 AGCAGATGATAGTTTTATTAGGG - Intergenic
954813861 3:53265143-53265165 AGATCCAGCTAGGTTTAGTAGGG + Intergenic
955884634 3:63584547-63584569 GGAAGATGCTATGTGTATTAGGG + Intronic
958602201 3:96310248-96310270 AGATGAATTTAAGTTTATTAAGG - Intergenic
959069630 3:101690250-101690272 AGATGCTGATAGGGATATTAAGG + Intergenic
961232743 3:125333450-125333472 AGATGATGCTAAATGAATTAGGG - Intronic
962983613 3:140513449-140513471 AGATGAAGCCAAGTTTATCATGG + Intronic
963423635 3:145094869-145094891 AGGAAATGTTAGGTTTATTAAGG - Intergenic
964300950 3:155284410-155284432 GGAAGATGCTATGTGTATTAGGG + Intergenic
969138167 4:5047885-5047907 AGATCATGCTGGGATTATCAGGG + Intergenic
969999763 4:11353235-11353257 TGATAATGCTAGGTTTCTTTGGG - Intergenic
973173458 4:47174632-47174654 ACTTGATGATAGGTTTATTGGGG + Intronic
974518223 4:62944242-62944264 GGATGATGCTAACTTGATTATGG + Intergenic
974842976 4:67319316-67319338 AGATAAGGGGAGGTTTATTATGG - Intergenic
975459805 4:74637918-74637940 AGCAGATGCTAGATTTCTTAAGG + Intergenic
976039353 4:80863809-80863831 TGATGATGCTATGTTTATAAAGG - Intronic
976859283 4:89643720-89643742 GGATGATTCTATATTTATTAAGG - Intergenic
976872519 4:89812660-89812682 AGAAGATGCAAGGGTTATTGTGG + Intronic
978173714 4:105704891-105704913 AGATGATGCTAGGTTGGTCTAGG - Intronic
978380757 4:108125831-108125853 AGGTAATCCTAGGTGTATTATGG + Intronic
978649440 4:110982601-110982623 GGATGATGCAAGTTTTAATAGGG + Intergenic
980598204 4:134983862-134983884 AGATTATGCATGGTTTATGAGGG + Intergenic
982437877 4:155399068-155399090 AGATGATGCTAGGTGTACGGAGG + Intergenic
982512133 4:156296378-156296400 AAATGTTGCTATGTTTATTTAGG - Intergenic
983748385 4:171231011-171231033 AGGTGATGCTCAGTATATTAAGG + Intergenic
983882500 4:172949231-172949253 ACAAGATGCTAGGTCTTTTAAGG + Intronic
984125854 4:175809319-175809341 AGATGATGCTAGGTTTATTATGG + Intronic
994975661 5:106801184-106801206 ATATGTTTCTATGTTTATTAAGG - Intergenic
995940582 5:117577953-117577975 AAATGTTGTTAGGATTATTATGG + Intergenic
998701369 5:144703609-144703631 AGATGAAGCAGAGTTTATTAAGG - Intergenic
1000506556 5:162127341-162127363 AGATCATTCTAGGTTTATATTGG + Intronic
1000780603 5:165475366-165475388 AGATGGTGCAAAGTTTAATATGG + Intergenic
1000927220 5:167208675-167208697 AGAAGATGTTCCGTTTATTAAGG - Intergenic
1004833337 6:19501357-19501379 AGGTGATGCTAAGTTTAAGACGG - Intergenic
1005786256 6:29248658-29248680 GGAGGATGCTATGTTTATTAGGG + Intergenic
1007142401 6:39588996-39589018 ATATTATGCTAAGTGTATTAGGG - Intronic
1008696344 6:54042778-54042800 AACTGATGTTAGCTTTATTAAGG - Intronic
1008824896 6:55682299-55682321 AGATGATGATAGGTTTTCTTAGG - Intergenic
1010892061 6:81325322-81325344 AGATGATGCTACCTTAATCAAGG - Intergenic
1011971301 6:93226511-93226533 AGAGGATGCTAGGATAGTTAAGG - Intergenic
1012696684 6:102392500-102392522 ATATGATTCTTGGTGTATTAAGG - Intergenic
1016883385 6:148933830-148933852 AGATAAAGGTAGATTTATTATGG + Intronic
1018276636 6:162139272-162139294 AGATGGTGATAGGTTAATTAAGG - Intronic
1020955249 7:14732792-14732814 AGAAGATGCCAGATTTATTAGGG - Intronic
1027553260 7:79628471-79628493 AGATGAGGCCTGTTTTATTAAGG - Intergenic
1028675898 7:93460174-93460196 AGATGATACTAGGTACACTAAGG - Intronic
1031744020 7:125470671-125470693 GTATGATGCTAGGTTTCTTCAGG + Intergenic
1031882312 7:127211095-127211117 ATATGAAGGGAGGTTTATTAAGG + Intronic
1033179281 7:139158947-139158969 TGATGAAGCTGGGTTTATTCTGG - Intronic
1034334448 7:150311626-150311648 GGAAGATGCTATGTGTATTAGGG - Intronic
1035750854 8:1995130-1995152 GCATGTTGCTAGGTATATTATGG + Intronic
1037618751 8:20544565-20544587 GGAAGATGCTAGGTGTATAATGG + Intergenic
1043061128 8:75504731-75504753 TGATGATGATTTGTTTATTAAGG + Intronic
1043211286 8:77521756-77521778 ACATGATACTAGGTTATTTATGG + Intergenic
1043721094 8:83547433-83547455 GGAAGATGCTATGTGTATTAGGG - Intergenic
1043833571 8:85018307-85018329 AGATGAGAGTAGATTTATTAGGG - Intergenic
1048480009 8:134780804-134780826 AGCTCATGCCAGGTTTATTAAGG - Intergenic
1048719834 8:137311309-137311331 AGGTGGTGCTAGGTATTTTAGGG - Intergenic
1048719998 8:137312602-137312624 AGGTGGTGCTAGGTATTTTAGGG + Intergenic
1050760376 9:9062001-9062023 TAAAGATGCTTGGTTTATTAAGG - Intronic
1055507004 9:76958261-76958283 AGATGATGGTAGGCTGTTTAAGG + Intergenic
1057595557 9:96413331-96413353 ACATGATGTTAGGTTTAACATGG + Intronic
1058217591 9:102254417-102254439 AGAGGATGCTAGGTATCTCAAGG + Intergenic
1058934078 9:109751705-109751727 AGATGAAGCTAGGATTTCTAGGG + Intronic
1186474404 X:9845975-9845997 AGATGATGCTATTTATATAAAGG - Intronic
1188670547 X:32876699-32876721 AGACAATGCTAGTTTTAGTAGGG - Intronic
1189697647 X:43681701-43681723 AGAAAATGCTAGTTATATTAGGG - Intronic
1190679054 X:52808878-52808900 ATATGAAGTAAGGTTTATTAAGG - Intergenic
1193043331 X:77026399-77026421 AGATGATGATGGCTTTTTTAGGG + Intergenic
1196557692 X:117109113-117109135 AGATAATGCTGTGTTTCTTAGGG + Intergenic
1197196037 X:123701392-123701414 AGATGATGCTTGGTTGCTTTTGG - Intronic
1199279124 X:145978622-145978644 AGAGGCTGCTAAGTTTTTTAGGG + Intergenic
1200007503 X:153097433-153097455 GGAAGATGCTAAGTGTATTAGGG + Intergenic