ID: 984127700

View in Genome Browser
Species Human (GRCh38)
Location 4:175832697-175832719
Sequence AGAAATCTTGCATGGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984127700_984127705 25 Left 984127700 4:175832697-175832719 CCCCCAAACCATGCAAGATTTCT 0: 1
1: 0
2: 1
3: 23
4: 235
Right 984127705 4:175832745-175832767 TTGATCTGTTATATTATTGAAGG 0: 1
1: 0
2: 0
3: 41
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984127700 Original CRISPR AGAAATCTTGCATGGTTTGG GGG (reversed) Intronic
901727894 1:11256757-11256779 GGGAATCTAGCATGGTGTGGTGG - Intronic
902784103 1:18721858-18721880 AGGGACATTGCATGGTTTGGGGG + Intronic
904454507 1:30639231-30639253 AGAGGCCTTGAATGGTTTGGAGG + Intergenic
907216952 1:52872389-52872411 AGAAATCTTGCCTGGTGTGGTGG - Intronic
908369228 1:63464298-63464320 ACAAATCTTGAATGCTTTGCAGG + Intronic
909618090 1:77635430-77635452 AGTAAACTTTCATTGTTTGGGGG + Intronic
911865437 1:103014247-103014269 AGAAATCTTGCGTGTTATGGTGG + Intronic
911976789 1:104507720-104507742 ACAAATCTTGCCGGGTGTGGTGG - Intergenic
914341832 1:146766486-146766508 AGAAATCTTGCCAGGTGTGGTGG - Intergenic
917310539 1:173673398-173673420 AGAAATATGGCAGGGTGTGGTGG - Intergenic
919441902 1:197645168-197645190 ACATATCTTGCAAGGTTTGATGG - Intronic
919461960 1:197888286-197888308 TAAAATCTTGAATTGTTTGGAGG - Intergenic
920744135 1:208609687-208609709 AGAAATTTAGAATGGGTTGGAGG - Intergenic
922583398 1:226715756-226715778 GGAAATCTTGCACGTTTTGAAGG - Intronic
922661922 1:227437605-227437627 AGAATGCTTGGATGGGTTGGGGG - Intergenic
923904831 1:238372212-238372234 AGAAGTCTGGCATGGTGTAGCGG - Intergenic
1063085437 10:2813756-2813778 AGTAATCTTGCATAGATTGTGGG - Intergenic
1064207226 10:13334555-13334577 AAAAATATTGCTTGGTGTGGTGG + Intronic
1064760516 10:18614899-18614921 AGAAATCTTTTAAGGCTTGGGGG - Intronic
1067074849 10:43171661-43171683 AATATTCTTGCCTGGTTTGGAGG + Intronic
1067405387 10:46018561-46018583 AGAAGTGTTTCATGGTTTTGAGG - Intronic
1067481161 10:46598397-46598419 AGAGAAGTTGCATGGTTAGGTGG - Intergenic
1067613591 10:47743425-47743447 AGAGAAGTTGCATGGTTAGGTGG + Intergenic
1069809777 10:71149752-71149774 AGAGATCTAGCATGGATGGGAGG + Intergenic
1071040735 10:81306656-81306678 GGAAATATTGTAAGGTTTGGTGG + Intergenic
1071629000 10:87203388-87203410 AGAGAAGTTGCATGGTTAGGTGG + Intergenic
1072009537 10:91291258-91291280 AGAAATCTTTCTTGGTTTTCTGG + Intergenic
1072345847 10:94505289-94505311 AGGAATTTTGCCTGGTGTGGTGG + Intronic
1072505283 10:96060109-96060131 AGAAAACTTGAATTATTTGGGGG + Intronic
1072737168 10:97886930-97886952 AGAAATCTGGCCGGGTGTGGTGG - Intronic
1074066970 10:110024899-110024921 AGGAAACTTGAGTGGTTTGGGGG - Intronic
1074107574 10:110400026-110400048 AATAATCTTGGATGGTTGGGTGG - Intergenic
1074320756 10:112400006-112400028 ATAAATCTTTCATTGTCTGGAGG - Intronic
1077921534 11:6645411-6645433 AGAAAGCAGTCATGGTTTGGAGG + Intronic
1078967802 11:16367360-16367382 ATAAATCTAGCATGGTGTGAGGG - Intronic
1079277815 11:19058202-19058224 AGAAAACTCTCATGGGTTGGAGG + Intronic
1080422176 11:32120140-32120162 AGAAATCTTGCTTGGTCTCTTGG + Intergenic
1080708419 11:34721542-34721564 TGCAACCTGGCATGGTTTGGGGG + Intergenic
1080772986 11:35360017-35360039 AGAAATCTTGGATGGGTTAAGGG - Intronic
1083111089 11:60407962-60407984 AGAAAACCTTCATGATTTGGGGG - Intronic
1084090309 11:66875328-66875350 AGAAATCCTGTATGGGTGGGTGG + Intronic
1087435068 11:98105920-98105942 TGCCATCTTGCATGTTTTGGTGG - Intergenic
1087818766 11:102688245-102688267 AAAAATCTTGCTGGGTGTGGTGG + Intergenic
1089313463 11:117574901-117574923 AGAAATCCTGCCGGGTGTGGTGG + Intronic
1090550569 11:127815321-127815343 AGAAGTCTGGCTTGGTTTGGGGG + Intergenic
1092830701 12:12441750-12441772 AGAAATCCTGCAGGGTTTGAAGG - Intronic
1093183797 12:15996835-15996857 AGCAATGTTGAATGGTTTTGTGG + Intronic
1094332407 12:29308929-29308951 AGGAATCATGAATGGTTTTGTGG - Intronic
1095272662 12:40238262-40238284 AGAAGTATTGCTTGTTTTGGTGG + Intronic
1095464909 12:42480236-42480258 ACAAATTTTGAAAGGTTTGGAGG - Intronic
1098829109 12:75338366-75338388 AGAAATCTGACTTGGATTGGGGG + Intronic
1100177364 12:92046223-92046245 TGGAAGCTTGGATGGTTTGGGGG - Intronic
1100904532 12:99282429-99282451 AAAAACCTTGGAGGGTTTGGGGG + Intronic
1100943324 12:99749263-99749285 AGAAATCTTGCTTGAATTTGGGG + Intronic
1101955499 12:109208912-109208934 AGAAAGCCAGCATGGTGTGGGGG - Intronic
1102024361 12:109705299-109705321 TGAAATCTTGCAGGGCTGGGAGG - Intergenic
1102299399 12:111760063-111760085 AGAAATCTGGCCGGGTGTGGTGG - Intronic
1102373808 12:112404635-112404657 ACAAATCTGGCAGGGTGTGGTGG + Intergenic
1106163884 13:27224795-27224817 AGAAATCTAGCCAGGTATGGCGG - Intergenic
1106788037 13:33126597-33126619 AGAAATCTGGCTGGGGTTGGAGG + Intronic
1108507438 13:51125210-51125232 ATAAATCTTTCAAGGTTTGCAGG + Intergenic
1108913962 13:55586081-55586103 AGAAATGTTTCATCGTTTGATGG + Intergenic
1109132238 13:58601850-58601872 AGATATCTGATATGGTTTGGCGG - Intergenic
1109514478 13:63424152-63424174 AGACATATTGCCAGGTTTGGTGG + Intergenic
1109550400 13:63890236-63890258 AGAAATGTTGCATTGTTATGAGG - Intergenic
1109674036 13:65649363-65649385 AGAAATGTTTCATGATTTGCTGG + Intergenic
1110143537 13:72160738-72160760 AGAAAGCTTTCATGATTTGTTGG - Intergenic
1111277858 13:85974848-85974870 AGGAATCCTGCATAGTTTGTGGG + Intergenic
1114502655 14:23182557-23182579 AGAATCTTTGCCTGGTTTGGAGG + Intronic
1115243521 14:31272277-31272299 AGAAATCTTGCATTCCTTGTTGG - Intergenic
1115291964 14:31782501-31782523 AGAAATCTTGCTGGGTGTGGTGG + Intronic
1115730512 14:36264232-36264254 AGAGATCATGCTTGGCTTGGGGG - Intergenic
1116856512 14:49957187-49957209 GGAGATGTTGCATGATTTGGAGG + Intergenic
1117130081 14:52677575-52677597 AGAAATCTGGCCTGGTGTGGAGG + Intronic
1117828227 14:59725661-59725683 AGACATGTGGCATGGTGTGGGGG - Intronic
1119771796 14:77224731-77224753 TGAAACCTGGCGTGGTTTGGTGG - Intronic
1121723103 14:96125717-96125739 AGAAATCTGGCCTGGCTTGCTGG - Intergenic
1121861341 14:97321526-97321548 AGAAATCTGGCCTGGCGTGGTGG - Intergenic
1121925863 14:97926838-97926860 AGAAATCCCACATGGTATGGCGG - Intronic
1123133604 14:106007684-106007706 ACAGATCTTGGAGGGTTTGGAGG + Intergenic
1123583628 15:21738130-21738152 ACAGATCTTGGAGGGTTTGGAGG + Intergenic
1123620278 15:22180733-22180755 ACAGATCTTGGAGGGTTTGGAGG + Intergenic
1124083896 15:26528492-26528514 ATACATCGTGCATGGGTTGGAGG - Intergenic
1127316864 15:57804457-57804479 GGAATTCATGGATGGTTTGGGGG + Intergenic
1127470439 15:59285234-59285256 AGCAATCTTGCAAGGTGTGGCGG + Intronic
1127609079 15:60619773-60619795 TGAAATCTTGAGTGGTTTGGTGG - Intronic
1127816918 15:62619160-62619182 AGAAATCTTTCTTGGATTGGAGG + Intronic
1129072865 15:72965630-72965652 AGTAAACTTTCATGGTTTTGAGG + Intergenic
1129314791 15:74735172-74735194 AAAAATCCTCCATGTTTTGGTGG + Intergenic
1130242663 15:82210910-82210932 GCCATTCTTGCATGGTTTGGTGG - Intronic
1130433909 15:83876943-83876965 AGAAAACTTGCTGGGTGTGGTGG - Intronic
1130436757 15:83907689-83907711 TGAAATCTGGCAGGGTGTGGTGG - Intronic
1130771829 15:86931875-86931897 AAAATTCTTGAATGGTTTAGGGG + Intronic
1133480761 16:6168253-6168275 AGAAATCGTGCATGGTGCGGAGG + Intronic
1133533715 16:6679688-6679710 AGTACTCTTGTATGGTGTGGTGG - Intronic
1133780985 16:8939090-8939112 AGAAATCTTCATTGGGTTGGTGG - Intronic
1134077035 16:11299288-11299310 AGAAAACTGGCAGGGTGTGGTGG + Intronic
1139992444 16:70950939-70950961 AGAAATCTTGCCAGGTGTGGTGG + Intronic
1144158277 17:12530155-12530177 AGAAGTCTTGGAGAGTTTGGTGG + Intergenic
1144364271 17:14526920-14526942 AGAAATTTTGCCTAGTTTAGAGG - Intergenic
1147798148 17:43060656-43060678 AAAAAACTAGCATGGTGTGGTGG - Intronic
1148459341 17:47829599-47829621 AGAAATTTTGCTGGGTGTGGTGG + Exonic
1148797299 17:50203208-50203230 TGGAATCTTGGATGGTTTGGGGG - Intergenic
1149151262 17:53566723-53566745 AGATATGTAGCCTGGTTTGGGGG + Intergenic
1150874979 17:68960937-68960959 AGAAATATTTCCTGTTTTGGAGG + Intergenic
1154467854 18:14667230-14667252 AAAAATCTGGCCAGGTTTGGTGG - Intergenic
1157107005 18:44783197-44783219 AGATATTTTGCATGTTTTGGGGG + Intronic
1158427051 18:57349740-57349762 AAAAATCTCCCAGGGTTTGGGGG - Intergenic
1158982136 18:62773537-62773559 AAAAATCTGGCATGTTTTGGAGG - Intronic
1159364912 18:67453236-67453258 AGAAATCTTGTATCCTTTGAGGG - Intergenic
1160656526 19:274761-274783 AGAAGTCTTCCTAGGTTTGGTGG - Intergenic
1161696301 19:5770491-5770513 AGAAATTTTGCTGGGCTTGGTGG + Intronic
1161912248 19:7203275-7203297 AGAGCTTTTGCATGGTTTGAAGG - Intronic
1162440703 19:10690415-10690437 GGAAATTTTGCAATGTTTGGAGG + Exonic
1162607455 19:11720851-11720873 AAAAATCTTGCACTGTTTGTTGG - Intergenic
1163965186 19:20739707-20739729 AGAAATATTGCTGGGTGTGGTGG + Intronic
1167091056 19:47344192-47344214 AGAAAATTAGCCTGGTTTGGTGG + Intergenic
1167200359 19:48061133-48061155 AGAAAACTAGCCTGGTGTGGTGG + Intronic
1168064389 19:53910661-53910683 AAAAATCTTGCAGGGGTCGGGGG + Intronic
1168398491 19:56068606-56068628 AGAAACCTGGCAGGGTGTGGTGG + Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
925678153 2:6388072-6388094 ATATATCAGGCATGGTTTGGAGG + Intergenic
925946476 2:8868746-8868768 AGACATCATGCATGAGTTGGGGG + Intronic
927078942 2:19608931-19608953 AGAAATCTTGCATTCTTTAAAGG - Intergenic
931185923 2:59951319-59951341 AAAAATTTTGCATTCTTTGGGGG - Intergenic
931342232 2:61413029-61413051 AGAAATTTTGTCTGTTTTGGTGG - Intronic
931618512 2:64186533-64186555 AGAAATGTTGCTTGGTTTTCTGG + Intergenic
931664501 2:64600494-64600516 AGTAATCCTGCTGGGTTTGGGGG - Intergenic
932909944 2:75795416-75795438 AGAAATCTTGCATGGAGTAAAGG - Intergenic
933244321 2:79958322-79958344 AGAAATCTTCCATGGTTAAAGGG + Intronic
933470209 2:82712916-82712938 AGAAATCCTACAGGGTTTTGAGG - Intergenic
933657284 2:84899439-84899461 AGAAATCTTCCAATGTTTGGGGG + Intronic
942919364 2:181352578-181352600 AGGAATCTATCCTGGTTTGGTGG + Intergenic
945880984 2:215324923-215324945 ATAAATTTTTCATGGCTTGGTGG + Intronic
946595518 2:221301819-221301841 AGATATTGTACATGGTTTGGGGG + Intergenic
948215786 2:236229552-236229574 AGAAAACTTGCCTGGCATGGTGG + Intronic
1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG + Intergenic
1171208424 20:23298993-23299015 GGAAATCTTGCTTGGGCTGGTGG - Intergenic
1172102270 20:32492221-32492243 AGTAATATTTCATGGTATGGGGG - Intronic
1173675065 20:44826507-44826529 CAAAATGTTGCATGGTTTGAAGG + Intergenic
1175290944 20:57874791-57874813 AGAAATCTTGCTGGATATGGTGG + Intergenic
1176806658 21:13490425-13490447 AAAAATCTGGCCAGGTTTGGTGG + Intergenic
1177860347 21:26445348-26445370 AAAAATCTAGCAAGTTTTGGTGG + Intergenic
1178351850 21:31877291-31877313 TGAAATCCTTCATGGTTTGCTGG + Intronic
1178828609 21:36035888-36035910 AGAAATCCTGCATGTCCTGGGGG + Exonic
1179558973 21:42200520-42200542 ACAATTTTTCCATGGTTTGGGGG + Intronic
1180970776 22:19814200-19814222 AGAAATCTGCCATGGCTGGGAGG + Intronic
1182020502 22:27077541-27077563 ATGACACTTGCATGGTTTGGTGG - Intergenic
951671150 3:25183486-25183508 AGTAATCCTGCAGGGTTTTGAGG - Intronic
954232720 3:49229976-49229998 AGAAAATTTGCAAGGTTTGAAGG + Intronic
955100702 3:55846862-55846884 AGAAAGCTTGCACAGTTTGTAGG + Intronic
955338091 3:58103693-58103715 AGAAATCTTGCTTGGCTACGAGG - Intronic
955515926 3:59726308-59726330 GTAATTCTGGCATGGTTTGGAGG - Intergenic
956088384 3:65637904-65637926 AGGAAACTCTCATGGTTTGGGGG - Intronic
956603126 3:71044679-71044701 AGAAATGTTGCAAGACTTGGGGG - Intronic
959185964 3:103048675-103048697 AGAAATCTATCATGGCTTAGTGG + Intergenic
959276697 3:104285639-104285661 AAAAAACTTGCAAGGTTTGAAGG - Intergenic
962472533 3:135724571-135724593 AGAACTCTTACATAGTGTGGTGG - Intergenic
962735228 3:138319626-138319648 ATAAATTATGCATGGTGTGGTGG - Intronic
964023300 3:152041289-152041311 AGAAATCTTGCCTTTTTTGTTGG + Intergenic
964482073 3:157149825-157149847 ATACATCTTACATGGCTTGGAGG + Exonic
965863830 3:173181244-173181266 AGAAATGTTGCATGTATGGGAGG - Intergenic
965972715 3:174582189-174582211 AGAAATCTTGAAGGTTTTCGTGG + Intronic
967228077 3:187312286-187312308 AGAGAGCTGGCATGGTCTGGGGG - Intergenic
967228102 3:187312448-187312470 AGAGAGATGGCATGGTTTGGGGG - Intergenic
968853322 4:3099756-3099778 AGTGCTCTTGTATGGTTTGGAGG + Intronic
968853331 4:3099844-3099866 AGTGCTCTTGTATGGTTTGGAGG + Intronic
969120921 4:4910542-4910564 AGAAATCTGGCTGGGTGTGGTGG + Intergenic
972137001 4:35904820-35904842 AGAATTCTTGCCTTTTTTGGTGG + Intergenic
973248236 4:48033609-48033631 ACAATTCTTGCATTGTTTGCTGG + Intronic
973784404 4:54321558-54321580 AGCAACCTGGCATGGTTTGGGGG - Intergenic
976740779 4:88355091-88355113 AGTAATTTTGCATAGTTTAGAGG - Intergenic
977020514 4:91753469-91753491 AGATATGTTACATCGTTTGGAGG + Intergenic
977703902 4:100050972-100050994 AGAAAGTTTGCTTGATTTGGAGG + Intergenic
978818663 4:112938073-112938095 AGAGAAAATGCATGGTTTGGGGG - Intronic
982318078 4:154051197-154051219 ACACATAGTGCATGGTTTGGGGG + Intergenic
982555624 4:156859749-156859771 AGAAAGCTTGGATAGTTTGTGGG + Intronic
984127700 4:175832697-175832719 AGAAATCTTGCATGGTTTGGGGG - Intronic
987048167 5:14126872-14126894 AGAAAACTTGCATGGAGTTGGGG + Intergenic
988589728 5:32538369-32538391 AGAAACCTTGCTGGGTTTGGAGG + Intronic
988952124 5:36273813-36273835 AGACATTTTGCATGGTATTGTGG + Intronic
989393029 5:40922546-40922568 AGAAATTTTGCTGGGTGTGGTGG + Intronic
992037636 5:72796547-72796569 AGAAAGGCTCCATGGTTTGGTGG + Intergenic
992364275 5:76075878-76075900 AGAAGTGGTGCCTGGTTTGGAGG - Intergenic
992715933 5:79511591-79511613 ATATAACTTGCATGATTTGGGGG - Intronic
994323597 5:98422772-98422794 ACAATTTTTCCATGGTTTGGGGG + Intergenic
995992365 5:118256439-118256461 AGAAATCTTACAATGTATGGGGG + Intergenic
997225786 5:132208502-132208524 AGAAAAATTGCATGATTTGTGGG - Intronic
997673000 5:135691686-135691708 AGACATCTTGCAAGATTTGAGGG - Intergenic
999523655 5:152379217-152379239 AAAGATCTTGCATGGTTTGCAGG + Intergenic
999684194 5:154087889-154087911 GGAAACCTTGTATGGTTTTGGGG - Intronic
1000567798 5:162872117-162872139 AGAACTCATGCATTGTTGGGAGG - Intergenic
1005020331 6:21411780-21411802 AGAGATCATGCAGAGTTTGGAGG - Intergenic
1006752032 6:36384387-36384409 AGTGATCCTGCATTGTTTGGAGG + Intronic
1007419396 6:41710681-41710703 AGGGATCCTGCATGCTTTGGAGG - Intronic
1009051724 6:58283724-58283746 AGAAATGTTGAAAGGCTTGGAGG + Intergenic
1009443523 6:63711894-63711916 AGAAATCTTAAAGGTTTTGGTGG - Exonic
1011425616 6:87226276-87226298 ACAAATCATTCATGGTTTTGTGG + Intronic
1011622887 6:89259400-89259422 AGAAATTGTTCGTGGTTTGGGGG + Intronic
1012172207 6:96031412-96031434 AGAGAGGTTGCATGGTTTGCTGG + Intronic
1012300712 6:97584449-97584471 AGAAATGTTTCATGGGCTGGAGG - Intergenic
1012515201 6:100051253-100051275 TGAAATCTTCCATGGGATGGTGG + Intergenic
1012636761 6:101552473-101552495 AGAAATAATGCAGGGTTAGGAGG - Intronic
1012849339 6:104428230-104428252 AGAAAGCTAGTATGTTTTGGGGG - Intergenic
1013396548 6:109746691-109746713 AAACATCTTGCATGGTTGAGAGG + Intronic
1013990501 6:116249837-116249859 AAAAATCTTGGAAGGTTTGGTGG + Intergenic
1014014462 6:116514059-116514081 GGAAAACTGCCATGGTTTGGGGG + Intronic
1014717318 6:124881179-124881201 ATAAATGTTGCATGCATTGGAGG - Intergenic
1015257932 6:131200644-131200666 AGATATCTTGCATGGTTTTTTGG + Intronic
1015996550 6:139000375-139000397 AGAGATCTTCCAGGGATTGGTGG + Intergenic
1018276831 6:162141586-162141608 AGAAAACATGCTTGATTTGGAGG + Intronic
1018649736 6:165983394-165983416 AGCACTCTGGCATGGATTGGTGG + Intronic
1019206877 6:170369059-170369081 AGAAATCTTGAATGTTTTACTGG + Intronic
1021598790 7:22343666-22343688 ACACATTTTTCATGGTTTGGGGG - Intronic
1025112126 7:56226758-56226780 AGAAAACTTGAATTGTTTGGGGG - Intergenic
1028682054 7:93546846-93546868 AGAAGTCGTGCAGGGTGTGGTGG - Intronic
1029653945 7:101912145-101912167 AGAGTTCTGGCTTGGTTTGGTGG + Intronic
1031450651 7:121914024-121914046 AGAAACCTGGCCTGGTGTGGTGG + Intronic
1031827907 7:126589092-126589114 AGAAATTTTGCATGTTTGGTTGG - Intronic
1032500455 7:132395897-132395919 AGAAAGCTTTCACTGTTTGGGGG + Intronic
1034097475 7:148423372-148423394 AGAAAACTTGCATTTTTTTGTGG - Intergenic
1036524527 8:9522292-9522314 AGAAATGTGGCTTGGTGTGGTGG - Intergenic
1037418786 8:18679564-18679586 AGAAATCTTGCCGAGGTTGGTGG - Intronic
1037514103 8:19612445-19612467 AAGAATCTTGCAAGGTATGGCGG - Intronic
1038394276 8:27235588-27235610 AGAAGTCCTCCATGCTTTGGGGG - Exonic
1039102892 8:33959342-33959364 AAAATTCCTGCATGCTTTGGTGG + Intergenic
1039120374 8:34139638-34139660 AGAAATCTTGCAAGATGTAGAGG + Intergenic
1039149750 8:34490765-34490787 AAAAAAGATGCATGGTTTGGGGG - Intergenic
1039188597 8:34946220-34946242 AGAAAACTAGCAAGGTGTGGTGG - Intergenic
1042374217 8:68030553-68030575 AGACAGCTTTCATGGCTTGGAGG - Exonic
1045911009 8:107409981-107410003 ATAAATCTTGGATGGTTGGATGG - Intronic
1046603326 8:116343063-116343085 ATACATCTTCCAAGGTTTGGAGG - Intergenic
1046651584 8:116841818-116841840 ACAAATTTTGGATGGCTTGGGGG + Intronic
1047014733 8:120711702-120711724 AGAAATCCTGCATGACTTGTAGG - Intronic
1047486212 8:125333457-125333479 AGAAATCTAGCAAGGCGTGGTGG - Intronic
1050038516 9:1462931-1462953 ATAAATCTTGTGTGGTTGGGAGG + Intergenic
1050269853 9:3931357-3931379 AGAAATCTTGCATTCTTTCATGG - Intronic
1050421427 9:5469380-5469402 AGGAAACTTGAATGGCTTGGAGG - Exonic
1051277905 9:15414860-15414882 AGAAAATTTGCCTGGTGTGGTGG - Intergenic
1055117413 9:72620536-72620558 AGAAATCTGGCTAGGTATGGTGG - Intronic
1059240121 9:112797135-112797157 AGTTATCTTGTTTGGTTTGGAGG - Intronic
1060575945 9:124694272-124694294 TGTAATTTTGCATGTTTTGGGGG + Intronic
1061337782 9:129953196-129953218 AGAAATCTTGCCAGGTATGGTGG + Intronic
1185782763 X:2863359-2863381 AGAAATCTTGCCGGGCGTGGTGG - Intronic
1186650841 X:11558548-11558570 AGAAATTTTGCCAGGTGTGGTGG + Intronic
1187759408 X:22563837-22563859 AGAAAACTTGGGTTGTTTGGGGG + Intergenic
1189089276 X:38062265-38062287 AGAAGTATTTCATGTTTTGGCGG - Intronic
1189427657 X:40915787-40915809 AGAAATCTGGCCAGGTGTGGTGG - Intergenic
1194993620 X:100570635-100570657 AGAAATAATCCTTGGTTTGGCGG + Intergenic
1195410856 X:104566798-104566820 AGAAATCTTCCCTGGCTGGGGGG + Exonic
1195423028 X:104696599-104696621 TGAAATTTGGCAGGGTTTGGGGG + Intronic
1195695799 X:107666380-107666402 AAAAATCTAGCCTGGTGTGGTGG - Intergenic
1197866615 X:131025816-131025838 AGAAAACTTGGAGTGTTTGGAGG + Intergenic
1198370474 X:135984741-135984763 AAAAATCTTGGGTGGTGTGGTGG - Intergenic
1199218190 X:145285227-145285249 AGAAATGTTACATTGATTGGAGG - Intergenic
1199294964 X:146146669-146146691 AGAAATCTTCCCTGGTTTTGAGG - Intergenic
1199706063 X:150426437-150426459 GGAAATTTTGCATGGCTTGATGG - Intronic
1200870505 Y:8093160-8093182 AGAAATGTTGCATAACTTGGGGG + Intergenic
1201687296 Y:16720238-16720260 AGAAATCTTGCATAGTGTAAGGG + Intergenic
1201700354 Y:16874504-16874526 AAAAAAATTGCATGGCTTGGTGG - Intergenic