ID: 984130976

View in Genome Browser
Species Human (GRCh38)
Location 4:175875832-175875854
Sequence CTTTTGTTATTAAGTGCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984130973_984130976 22 Left 984130973 4:175875787-175875809 CCTTAAATTCTTTTAAGAACAGA 0: 1
1: 1
2: 6
3: 42
4: 568
Right 984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG No data
984130975_984130976 -3 Left 984130975 4:175875812-175875834 CCTTGGAAACAAAAATATTACTT 0: 1
1: 0
2: 5
3: 61
4: 651
Right 984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG No data
984130971_984130976 30 Left 984130971 4:175875779-175875801 CCTTGGTCCCTTAAATTCTTTTA 0: 1
1: 0
2: 2
3: 13
4: 292
Right 984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG No data
984130972_984130976 23 Left 984130972 4:175875786-175875808 CCCTTAAATTCTTTTAAGAACAG 0: 1
1: 0
2: 8
3: 39
4: 504
Right 984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984130976 Original CRISPR CTTTTGTTATTAAGTGCAAA CGG Intronic
No off target data available for this crispr