ID: 984131354

View in Genome Browser
Species Human (GRCh38)
Location 4:175879116-175879138
Sequence CAATGAAATTCAGACTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3505
Summary {0: 2, 1: 32, 2: 506, 3: 1219, 4: 1746}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131354_984131363 30 Left 984131354 4:175879116-175879138 CCCCCTCAGTCTGAATTTCATTG 0: 2
1: 32
2: 506
3: 1219
4: 1746
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131354_984131361 27 Left 984131354 4:175879116-175879138 CCCCCTCAGTCTGAATTTCATTG 0: 2
1: 32
2: 506
3: 1219
4: 1746
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131354_984131360 1 Left 984131354 4:175879116-175879138 CCCCCTCAGTCTGAATTTCATTG 0: 2
1: 32
2: 506
3: 1219
4: 1746
Right 984131360 4:175879140-175879162 CCATATCATTATTAGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131354 Original CRISPR CAATGAAATTCAGACTGAGG GGG (reversed) Intronic