ID: 984131354 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:175879116-175879138 |
| Sequence | CAATGAAATTCAGACTGAGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3505 | |||
| Summary | {0: 2, 1: 32, 2: 506, 3: 1219, 4: 1746} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984131354_984131363 | 30 | Left | 984131354 | 4:175879116-175879138 | CCCCCTCAGTCTGAATTTCATTG | 0: 2 1: 32 2: 506 3: 1219 4: 1746 |
||
| Right | 984131363 | 4:175879169-175879191 | CCATTCACCAAGTCTCTAGGAGG | 0: 1 1: 145 2: 152 3: 102 4: 137 |
||||
| 984131354_984131361 | 27 | Left | 984131354 | 4:175879116-175879138 | CCCCCTCAGTCTGAATTTCATTG | 0: 2 1: 32 2: 506 3: 1219 4: 1746 |
||
| Right | 984131361 | 4:175879166-175879188 | AAGCCATTCACCAAGTCTCTAGG | 0: 12 1: 1552 2: 1888 3: 1395 4: 912 |
||||
| 984131354_984131360 | 1 | Left | 984131354 | 4:175879116-175879138 | CCCCCTCAGTCTGAATTTCATTG | 0: 2 1: 32 2: 506 3: 1219 4: 1746 |
||
| Right | 984131360 | 4:175879140-175879162 | CCATATCATTATTAGCATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984131354 | Original CRISPR | CAATGAAATTCAGACTGAGG GGG (reversed) | Intronic | ||