ID: 984131355

View in Genome Browser
Species Human (GRCh38)
Location 4:175879117-175879139
Sequence GCAATGAAATTCAGACTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131355_984131361 26 Left 984131355 4:175879117-175879139 CCCCTCAGTCTGAATTTCATTGC No data
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131355_984131360 0 Left 984131355 4:175879117-175879139 CCCCTCAGTCTGAATTTCATTGC No data
Right 984131360 4:175879140-175879162 CCATATCATTATTAGCATTTTGG No data
984131355_984131363 29 Left 984131355 4:175879117-175879139 CCCCTCAGTCTGAATTTCATTGC No data
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131355 Original CRISPR GCAATGAAATTCAGACTGAG GGG (reversed) Intronic