ID: 984131356

View in Genome Browser
Species Human (GRCh38)
Location 4:175879118-175879140
Sequence GGCAATGAAATTCAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131356_984131361 25 Left 984131356 4:175879118-175879140 CCCTCAGTCTGAATTTCATTGCC 0: 1
1: 0
2: 2
3: 16
4: 237
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131356_984131360 -1 Left 984131356 4:175879118-175879140 CCCTCAGTCTGAATTTCATTGCC 0: 1
1: 0
2: 2
3: 16
4: 237
Right 984131360 4:175879140-175879162 CCATATCATTATTAGCATTTTGG No data
984131356_984131363 28 Left 984131356 4:175879118-175879140 CCCTCAGTCTGAATTTCATTGCC 0: 1
1: 0
2: 2
3: 16
4: 237
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131356 Original CRISPR GGCAATGAAATTCAGACTGA GGG (reversed) Intronic