ID: 984131356 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:175879118-175879140 |
| Sequence | GGCAATGAAATTCAGACTGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 256 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 237} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984131356_984131361 | 25 | Left | 984131356 | 4:175879118-175879140 | CCCTCAGTCTGAATTTCATTGCC | 0: 1 1: 0 2: 2 3: 16 4: 237 |
||
| Right | 984131361 | 4:175879166-175879188 | AAGCCATTCACCAAGTCTCTAGG | 0: 12 1: 1552 2: 1888 3: 1395 4: 912 |
||||
| 984131356_984131360 | -1 | Left | 984131356 | 4:175879118-175879140 | CCCTCAGTCTGAATTTCATTGCC | 0: 1 1: 0 2: 2 3: 16 4: 237 |
||
| Right | 984131360 | 4:175879140-175879162 | CCATATCATTATTAGCATTTTGG | No data | ||||
| 984131356_984131363 | 28 | Left | 984131356 | 4:175879118-175879140 | CCCTCAGTCTGAATTTCATTGCC | 0: 1 1: 0 2: 2 3: 16 4: 237 |
||
| Right | 984131363 | 4:175879169-175879191 | CCATTCACCAAGTCTCTAGGAGG | 0: 1 1: 145 2: 152 3: 102 4: 137 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984131356 | Original CRISPR | GGCAATGAAATTCAGACTGA GGG (reversed) | Intronic | ||