ID: 984131357

View in Genome Browser
Species Human (GRCh38)
Location 4:175879119-175879141
Sequence GGGCAATGAAATTCAGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1967
Summary {0: 1, 1: 1, 2: 66, 3: 526, 4: 1373}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131357_984131360 -2 Left 984131357 4:175879119-175879141 CCTCAGTCTGAATTTCATTGCCC 0: 1
1: 1
2: 66
3: 526
4: 1373
Right 984131360 4:175879140-175879162 CCATATCATTATTAGCATTTTGG No data
984131357_984131361 24 Left 984131357 4:175879119-175879141 CCTCAGTCTGAATTTCATTGCCC 0: 1
1: 1
2: 66
3: 526
4: 1373
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131357_984131363 27 Left 984131357 4:175879119-175879141 CCTCAGTCTGAATTTCATTGCCC 0: 1
1: 1
2: 66
3: 526
4: 1373
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131357 Original CRISPR GGGCAATGAAATTCAGACTG AGG (reversed) Intronic