ID: 984131358

View in Genome Browser
Species Human (GRCh38)
Location 4:175879139-175879161
Sequence CAAAATGCTAATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 18, 2: 60, 3: 120, 4: 446}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131358_984131363 7 Left 984131358 4:175879139-175879161 CCCATATCATTATTAGCATTTTG 0: 1
1: 18
2: 60
3: 120
4: 446
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131358_984131361 4 Left 984131358 4:175879139-175879161 CCCATATCATTATTAGCATTTTG 0: 1
1: 18
2: 60
3: 120
4: 446
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131358 Original CRISPR CAAAATGCTAATAATGATAT GGG (reversed) Intronic
901479950 1:9518397-9518419 CAAAATGCTTCTAATGTTCTGGG + Intergenic
902045763 1:13523046-13523068 CAAAATAATAATAATAATAGTGG + Intergenic
903434561 1:23336900-23336922 TAAAATGGTAATAATAATAATGG + Intronic
904182006 1:28672548-28672570 AAAAATAATAATAATAATATTGG - Intronic
904928641 1:34068464-34068486 CAACATGCTAATAATAACATGGG - Intronic
905113487 1:35616375-35616397 CAAAATCCTTAAAATGTTATTGG - Intronic
906939910 1:50246719-50246741 CATAAAGTAAATAATGATATCGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909480779 1:76127286-76127308 TAAAATGCTACTAATGATTTGGG - Intronic
909525130 1:76614019-76614041 CAAAATGCTTAAAATGTTTTGGG + Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909952057 1:81732405-81732427 GTAAATATTAATAATGATATTGG - Intronic
910333895 1:86106063-86106085 GAAAATGTAAAAAATGATATGGG - Intronic
910357950 1:86381903-86381925 CAAAATGTTAACAATGATTTTGG + Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911480343 1:98431050-98431072 CAAGATGCAAATCAAGATATAGG + Intergenic
911905583 1:103564580-103564602 CAAAATACCAAAAAAGATATTGG - Intronic
912033335 1:105277398-105277420 CAAAATGCTAATAAATGTTTTGG - Intergenic
912080553 1:105931362-105931384 CAAAATGCTAATAGCCAAATGGG + Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912389727 1:109294516-109294538 CAAAATGCTTATAATTTAATAGG + Intronic
913402063 1:118447766-118447788 AAAAATCCTAAACATGATATTGG + Intergenic
914845017 1:151278471-151278493 CAAAATAATAATAATAATAGGGG - Intergenic
914886549 1:151589645-151589667 CTAAATGCTAATCATGTTAGCGG + Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
916266408 1:162894098-162894120 TAAAATGAGAATAATAATATAGG + Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917973720 1:180225296-180225318 CAAAATGCAAATAATGAAAGGGG + Intergenic
918094601 1:181324384-181324406 CAGAATGATAAAAATGAAATAGG + Intergenic
918484541 1:185015465-185015487 CAAAATGCTAGTACTAATAAGGG - Intergenic
919347581 1:196404699-196404721 AAAAATGCTAAAAATTAGATGGG - Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919507910 1:198423541-198423563 CAAATTGGAAATAATGATAGAGG + Intergenic
921316520 1:213896773-213896795 CAAAATTTTAATAGTGGTATTGG - Intergenic
921553715 1:216570571-216570593 CAAAATTCTTATAATGAAAGAGG - Intronic
921682610 1:218052102-218052124 CAAAGTGCCAATAATTACATAGG + Intergenic
921685736 1:218087174-218087196 CAAAATTTTAATAATGCAATAGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923346074 1:233053829-233053851 CAAAATAATAATAATGAGAATGG - Intronic
923763311 1:236868258-236868280 AAAAATGCTAATGATCATCTGGG - Intronic
924069159 1:240257878-240257900 TAAAATGCTAGTAAGCATATTGG + Intronic
1063988840 10:11537553-11537575 AATAATGGTAATAATGCTATTGG - Intronic
1065102309 10:22342425-22342447 TTAAATGCTAACAATGATTTTGG + Intergenic
1065164290 10:22958718-22958740 CGAAATAATAATAATGATAATGG - Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065270175 10:24022461-24022483 CCAAATGCTAACAAAGATGTGGG + Intronic
1065608759 10:27449052-27449074 TAAAATGCATATAATGTTATGGG + Intergenic
1066211675 10:33246097-33246119 CAAAATGGTCAAAATCATATTGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066526183 10:36282437-36282459 CAAAACGATACTAATAATATAGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068108873 10:52654658-52654680 CAAATTGCTTGTAATGTTATTGG + Intergenic
1068456212 10:57257043-57257065 CAAAAAGCCAATAATTATTTCGG - Intergenic
1068878031 10:62018482-62018504 CGTAAAGATAATAATGATATTGG - Intronic
1069974854 10:72204930-72204952 CAAAGTGCTATTAATAATCTAGG + Intronic
1070911694 10:80124598-80124620 AATAATAATAATAATGATATTGG - Intergenic
1071230008 10:83575096-83575118 GAAAAAGCTAATAATAAAATAGG - Intergenic
1071324921 10:84504187-84504209 CTAAATGCTCATATTTATATGGG - Intronic
1071358323 10:84820034-84820056 TGAACTGCTTATAATGATATGGG - Intergenic
1072215719 10:93285789-93285811 CAAAATAATAATAATAATTTGGG - Intergenic
1072583940 10:96764992-96765014 CAGAATGCTAATAAAAATAGTGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072933545 10:99690066-99690088 TAAAATACTAATAATGTGATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1075897710 10:126011920-126011942 CAAAATGCTAACAAGAATAAAGG - Intergenic
1076989532 11:264168-264190 CAAAATAATAATAATAATTTGGG + Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078029246 11:7732489-7732511 AAAAATGCTAAAATTCATATGGG + Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079402983 11:20120986-20121008 CAAACTGCCAAGAATGATACAGG + Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079850304 11:25525003-25525025 CTAAATTCAAATAATGATATTGG - Intergenic
1079872817 11:25821779-25821801 CAAAATGCCAATAGTGATGCAGG + Intergenic
1079921418 11:26437839-26437861 AAAAATCCTAATAAAAATATTGG + Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080346099 11:31327553-31327575 CATAATGATAATAACGATAATGG - Intronic
1080509554 11:32954458-32954480 CAAACTACTAATAATGAATTGGG - Intronic
1081106901 11:39081431-39081453 CAAAACCTTAATAATAATATTGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081133443 11:39408510-39408532 CAAAATTCTAAAATTTATATAGG + Intergenic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082769953 11:57200155-57200177 CAAGACTCTAATAATGAGATAGG - Intergenic
1085552517 11:77387685-77387707 CAAAAGCCTACTAATGATATAGG + Intronic
1086288997 11:85283726-85283748 AATAATGCTACTAAAGATATAGG + Intronic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087198650 11:95323313-95323335 CAAAATGCCAAAGATAATATGGG - Intergenic
1087387917 11:97496381-97496403 CTAAGTGCTAATAATGATCTTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088726570 11:112642602-112642624 CAAAATCATAATAATGATATGGG - Intergenic
1089381968 11:118039709-118039731 CAAAATAATAATAATAATAATGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090685477 11:129113107-129113129 CAAAATGCTACTAGTGATGCTGG - Intronic
1092167560 12:6352235-6352257 CAAAATAATAATAATAATAATGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093542462 12:20304047-20304069 CATAAAGCAAATAATGAAATGGG + Intergenic
1093668026 12:21837875-21837897 CAAAATGCTAACTATAATAAAGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095520348 12:43056408-43056430 CAAGATGCATAAAATGATATGGG + Intergenic
1095651210 12:44611690-44611712 GAAAATGGTTACAATGATATTGG - Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097346310 12:58497223-58497245 AAAAATGATAATAATAATAACGG + Intergenic
1097582082 12:61470760-61470782 CAAAATGTTCATTATGATAACGG + Intergenic
1097816827 12:64083570-64083592 GAAAATGATAATAATGAGTTTGG - Intronic
1098394159 12:70000949-70000971 CAAAATGGGAACAATAATATTGG + Intergenic
1098408323 12:70151242-70151264 CCAAGTGCTCATAATCATATTGG + Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099510167 12:83525128-83525150 CAAAATGCAAATAGAGAAATTGG + Intergenic
1099554498 12:84094109-84094131 CATAATACAAATAATGTTATAGG - Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100733547 12:97500662-97500684 CAAAATGCATATCATAATATCGG - Intergenic
1101035309 12:100700005-100700027 AAAAATAATAATAATGATAATGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102411465 12:112723563-112723585 CAAAATGCCATTAGTGATGTTGG - Intronic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1103113379 12:118302860-118302882 CAAAATGGTAGTCGTGATATTGG - Intronic
1103283480 12:119780204-119780226 GAAATTGCTAGTAATGATCTAGG + Intronic
1103985444 12:124764201-124764223 CAAAATAATAATAATAATAATGG + Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105479922 13:20765369-20765391 CAGAAAGCAAATAATGAAATAGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106052804 13:26207279-26207301 CTAAATGGTAAAAATGAGATTGG + Intronic
1106105035 13:26725336-26725358 CCAAATGCTAGTGAGGATATGGG - Intergenic
1106255548 13:28019339-28019361 CAAAAAGCTAAAAATGAGTTTGG + Intronic
1108626773 13:52236546-52236568 AATAATAATAATAATGATATAGG + Intergenic
1108659296 13:52569912-52569934 AATAATAATAATAATGATATAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109377585 13:61517779-61517801 AAATATGTTAATAAAGATATTGG - Intergenic
1109438721 13:62341352-62341374 CAAAATGCTAAGATTGATCACGG - Intergenic
1109499856 13:63219560-63219582 CACAAATGTAATAATGATATAGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110096367 13:71527977-71527999 CAAGATGATAACAATGTTATGGG + Intronic
1110477642 13:75936005-75936027 CAACATGCTAATAAGCATAGTGG + Intergenic
1110711673 13:78657361-78657383 ACAAATGGTAATAATGATAGAGG + Intronic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111077159 13:83251796-83251818 CAAAATGATTGTAATAATATAGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111270772 13:85881330-85881352 CAAAATGCCATTAATGATTCTGG - Intergenic
1111413747 13:87912116-87912138 CAAGTTTCTAAAAATGATATGGG + Intergenic
1111647158 13:91045983-91046005 GAAAATGTTAATAATTATATTGG - Intergenic
1112174310 13:97006737-97006759 TAAAATGGGAATAATGATAGAGG - Intergenic
1112258617 13:97857344-97857366 AAAAATTTTAATAATGATCTTGG + Intergenic
1112674589 13:101685463-101685485 CCATCTGCTAATAATGATCTTGG + Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113615013 13:111674138-111674160 GAAGATGCTAATAATAATAATGG + Intergenic
1113620482 13:111759052-111759074 GAAGATGCTAATAATAATAATGG + Intergenic
1114235327 14:20818700-20818722 TAAAATGTTAATAATGTTGTAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114867124 14:26609811-26609833 CCACATGCAAATAATGAAATTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115042987 14:28954801-28954823 CATAATACTTATAATGATAATGG + Intergenic
1115632949 14:35263691-35263713 AAAAATAATAATAATAATATTGG + Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116373468 14:44166887-44166909 CAAAATGCTACTAACCTTATTGG - Intergenic
1116377942 14:44227641-44227663 CTAAATGCATATAATGATTTGGG + Intergenic
1116618500 14:47168794-47168816 TAAAATGCTAATAAGGCTAATGG + Intronic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1117279657 14:54225984-54226006 CAAAATATTAAAAATGATCTGGG - Intergenic
1117550456 14:56831101-56831123 CAAAATCCTAACAGTGGTATAGG - Intergenic
1117765502 14:59078132-59078154 CGAACTGTTAAAAATGATATAGG - Intergenic
1118832636 14:69448941-69448963 CAAAATGTTAATCAATATATTGG + Intronic
1118920835 14:70148685-70148707 CAAAAATATAATAATAATATCGG - Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1119412042 14:74438538-74438560 CAAATTGCTAATAATTATTGAGG + Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120690116 14:87582952-87582974 CAAAATGTTAATAATGGGAGAGG + Intergenic
1120799874 14:88676000-88676022 CAAAATGCTGATGATGACACAGG - Intronic
1121294276 14:92804990-92805012 CAAAAAGCTAATAATCAAGTGGG - Intronic
1121468519 14:94132281-94132303 CAAAAAGCTCATAATTATTTAGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123754853 15:23389214-23389236 CAAAATGGTAATGATGACCTAGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124144310 15:27108938-27108960 GAAAATGCTCATAATAAAATAGG + Intronic
1124144313 15:27109015-27109037 ACAAATGCTCATAATAATATAGG - Intronic
1125790635 15:42363014-42363036 GATAATGATAATAATGATAAAGG + Intronic
1126107325 15:45155251-45155273 CAAAAACCAAATAATGACATTGG + Intronic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127664365 15:61130816-61130838 CAAAATGTTCATAATAAAATGGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131183056 15:90253585-90253607 CAAAGTGCAAATCATGAGATAGG - Intronic
1131368319 15:91858408-91858430 CAAAATGTTAATAATTATTAAGG + Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1132410734 15:101576746-101576768 CAGAATGCTAAAAATTAAATGGG + Intergenic
1134284917 16:12852929-12852951 CAAGATAATAATAATGAAATTGG + Intergenic
1134461521 16:14433766-14433788 CAAAATGGTAATGATGACCTAGG + Intergenic
1134474148 16:14556874-14556896 TTAAATGATAATAATGATGTGGG - Intronic
1135132883 16:19867431-19867453 TAAAATGCTCAGAATGATACCGG + Intronic
1135229960 16:20697447-20697469 CAAAATGACAATGGTGATATTGG - Intronic
1135555419 16:23432165-23432187 CAAAATCCTAAGAATGAATTAGG + Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137369673 16:47893711-47893733 TAAGATGGAAATAATGATATAGG - Intergenic
1138055147 16:53825024-53825046 CAAAATTCTAATAATTCTACTGG - Intronic
1138570129 16:57865471-57865493 CAAAATAATAATAATAAAATAGG + Intergenic
1138700698 16:58859874-58859896 CTAAATGCAAATAAATATATTGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1145047652 17:19630835-19630857 CAAAATGGTAAAAATGCTATTGG + Intergenic
1149261068 17:54879937-54879959 CACAATGGTAATAAATATATAGG + Intergenic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1154347788 18:13557892-13557914 CAAAGTGAAAATAATGAGATTGG - Intronic
1155103354 18:22636358-22636380 CAAAATTCTAATAATGGTTGTGG + Intergenic
1155655507 18:28187632-28187654 AAAAATATTAATTATGATATTGG - Intergenic
1155947023 18:31865489-31865511 TAAAATGCTAATAAGGATTTGGG - Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157045934 18:44101792-44101814 CAAAATACCACTAATGATACCGG + Intergenic
1158949642 18:62481827-62481849 CAAAATACTATTAATAAAATTGG + Intergenic
1159516106 18:69459940-69459962 CTAAATGCTATTAAAGAAATAGG - Intronic
1160255115 18:77241843-77241865 CAAAATGATAAAAATTAAATAGG - Intergenic
1162210253 19:9085656-9085678 CAAAATAATAATAATAATAATGG + Intergenic
1162868577 19:13568226-13568248 CTAAATGATAATAATAATAATGG + Intronic
1163107014 19:15129697-15129719 TAAAATTCTAATTATGATAGTGG + Intergenic
1165611466 19:37157003-37157025 CAAAATGCAAATCATGAACTAGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166951711 19:46432827-46432849 CAAAATAATAATAATAATATAGG - Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925323204 2:2993028-2993050 GAGAAAGCTAATAATGATATAGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926399096 2:12477280-12477302 CCAAATGCTAATAGTCTTATAGG - Intergenic
928497132 2:31844735-31844757 CAAAAGGGTAATAATAATACAGG - Intergenic
928591913 2:32825978-32826000 GAAAATGCTAATAAACATTTTGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929988726 2:46765393-46765415 AAAAATACTAAAAATGAAATGGG + Intergenic
930221599 2:48751884-48751906 GAAAATGCTAATAATAATTATGG - Intronic
930544028 2:52744787-52744809 CACACTGCTAATAAAGAAATAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931510035 2:62981536-62981558 AAAAATCCTATTAATGATATGGG + Intronic
932574907 2:72957327-72957349 CAAACTGCAAATAATAATAATGG - Intronic
932610111 2:73192515-73192537 AAAAATGGTAATAATAATAATGG - Intergenic
932931029 2:76039175-76039197 GAAAATGCTAAGCATGAAATAGG + Intergenic
932947668 2:76255933-76255955 AAAAATGCCAATATAGATATAGG + Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933426234 2:82115381-82115403 CAAAATGATAAGCAAGATATGGG - Intergenic
933494875 2:83037579-83037601 CAAAATAATAATAATAATAAAGG + Intergenic
934049362 2:88197642-88197664 CAAAATGACAATGATGATGTTGG - Intergenic
934130480 2:88943529-88943551 CAAAATGCTATTAATGAGCAGGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
938621498 2:133059335-133059357 AAAAATGCTAACAATCATCTGGG - Intronic
938768259 2:134478391-134478413 CATAATGCTCATAAAAATATGGG + Intronic
939330815 2:140758242-140758264 CAAATTGCTAATCATAACATAGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940049532 2:149447713-149447735 CAACATGCAAATAAAAATATTGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940389757 2:153118520-153118542 AAAAAGGCTAATAATAATAGTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941206420 2:162578862-162578884 GAAAATAATAATAATAATATTGG - Intronic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941692049 2:168510742-168510764 CAAGATGATAGTAATGATAATGG - Intronic
941774781 2:169381131-169381153 CAACATGATAAAACTGATATAGG + Intergenic
942762541 2:179416575-179416597 AAAAATAATAATAATGATAACGG + Intergenic
943338616 2:186649800-186649822 AAACATGTTAATAATGATAATGG - Intronic
943361985 2:186930795-186930817 CAAAATGCTAGCAAGGATGTGGG - Intergenic
943392728 2:187289890-187289912 CCAAATGGTAAAAATGATATGGG - Intergenic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
943668954 2:190640104-190640126 AGAAATGCTCATAATGTTATGGG - Intergenic
943869299 2:192973631-192973653 TAAACTGCTCATAATTATATTGG + Intergenic
943939644 2:193975878-193975900 AAAGATGCTATTTATGATATAGG - Intergenic
944100615 2:196022174-196022196 CAAAATACTAACAATCATCTGGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945645599 2:212488354-212488376 CAATATGCTAAAAATAACATTGG + Intronic
945807376 2:214506429-214506451 GAAATTCTTAATAATGATATAGG - Intronic
945869826 2:215214975-215214997 CAAAATAATAATAATAATAAAGG + Intergenic
946713357 2:222528486-222528508 AAAAATGCTAACAATGATCTGGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
948119630 2:235519768-235519790 AATAATGATAATAATAATATTGG - Intronic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170903972 20:20494743-20494765 CAAAATGCTAGATGTGATATGGG + Intronic
1171064217 20:21997112-21997134 CAAAATAATAAAAAGGATATGGG + Intergenic
1172903134 20:38349429-38349451 CTTAATGCTAATAAGGATGTTGG + Intronic
1172952764 20:38732402-38732424 AAAAATGATAATAATTATTTGGG - Intergenic
1173240808 20:41295384-41295406 AAAAATGCTTACAATGACATGGG + Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1175043028 20:56074030-56074052 AAAAATGCCAGTAAGGATATAGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176704231 21:10099171-10099193 TAAAATGATAATACTAATATTGG - Intergenic
1177017818 21:15814299-15814321 CAAGCTGCTAATAAAGACATAGG - Intronic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178370123 21:32020516-32020538 CAATAAGCTAATAAGGAGATTGG - Intronic
1178508145 21:33179928-33179950 AAAAATGCTTATTATGATAGAGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1184157794 22:42679912-42679934 TAAAATAATAATAATGAGATGGG - Intergenic
949487071 3:4550099-4550121 CAACTTGCTAATAATGACAGGGG - Intronic
949506440 3:4732535-4732557 CAAAAACCTCATAATGCTATAGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951325282 3:21295372-21295394 CAAAATAATAATAATAATAATGG - Intergenic
952112577 3:30141120-30141142 CAAAATGATAAGAAAAATATGGG + Intergenic
952201755 3:31136494-31136516 CAACATCCTATTAATGATAAAGG + Intergenic
952815687 3:37445583-37445605 CTAAATGTTAATAATGATTATGG - Intergenic
952815951 3:37448176-37448198 CCAAACCCTAAAAATGATATCGG - Intergenic
955675566 3:61444679-61444701 CAAAAAGCTGATGAAGATATGGG - Intergenic
957161314 3:76612714-76612736 AAAAATAATAATAATAATATTGG + Intronic
957379229 3:79403823-79403845 TACAATGGAAATAATGATATGGG + Intronic
957602313 3:82353593-82353615 CAAAATGCTATTAAAAACATGGG + Intergenic
957640209 3:82843967-82843989 CACAATGAAAAAAATGATATAGG + Intergenic
957796535 3:85016360-85016382 GAAAATGGAAATAAAGATATAGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958271404 3:91504020-91504042 CAAAATAATAATGATGTTATGGG - Intergenic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959275931 3:104277653-104277675 CAAAATGATAATAATGAACTTGG - Intergenic
959604449 3:108226908-108226930 CAAAATGCTATTAAAACTATGGG + Intergenic
959669414 3:108958919-108958941 AAAAATGCTAATAAGAAAATTGG - Exonic
959714311 3:109416195-109416217 CAAAATAATAATAATAATAAAGG - Intergenic
960009555 3:112818695-112818717 CAAAAGGCAAATAATGATGCTGG - Intronic
960109738 3:113834176-113834198 CAAAATAATAATAATAATAATGG - Intronic
960749393 3:120930020-120930042 CAAGATGCAAATAATGAACTGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963339410 3:144016489-144016511 AAAAATGTTAAGAAAGATATGGG + Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963951242 3:151204381-151204403 AAAGATGCTTATGATGATATTGG + Intronic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964105367 3:153034069-153034091 TAAAATAATAATAATAATATTGG - Intergenic
964172442 3:153786830-153786852 CAAAAGGATAATGATGACATAGG - Intergenic
964441081 3:156710896-156710918 AAAAATAATAGTAATGATATTGG + Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964590479 3:158358006-158358028 GTAAATGTTAATAATGTTATTGG + Intronic
965029365 3:163343953-163343975 CTACATACTAATAATGATAAAGG + Intergenic
965235791 3:166119811-166119833 AAAAATGCTAATGATCATCTGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967099477 3:186204405-186204427 CAAAATAATAATAATAATAATGG + Intronic
967455669 3:189683617-189683639 CAATATGCTAAATATGATAGGGG - Intronic
968195054 3:196699577-196699599 CAAAATGCTTACTATGGTATTGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970364689 4:15346739-15346761 GGGAATGCTAATAATGATCTGGG - Intronic
970604729 4:17668325-17668347 CAAGCTACTAAGAATGATATAGG - Intronic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971079610 4:23195159-23195181 CAATATGCTAATAATGGGATGGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971707665 4:30068012-30068034 GAAAATACTAAGATTGATATAGG + Intergenic
972840684 4:42927020-42927042 CAGAATAATAATAATGATTTGGG - Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
972952188 4:44341213-44341235 AAAAATGCTAACAATCATCTGGG + Intronic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973805490 4:54522087-54522109 CAAAATGATAAGAATTACATTGG + Intergenic
974272573 4:59670328-59670350 TGAAATGCAAATAATGATTTTGG + Intergenic
974625859 4:64428543-64428565 CAAAATGCTAATCATAATACAGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
974731497 4:65872323-65872345 CAAAATAATAATAATAATAATGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975621849 4:76304714-76304736 AAAAATGCCAATAATGCTCTAGG + Intronic
975842978 4:78495755-78495777 CAAAATAATAATAATAATAAAGG - Intronic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
976979020 4:91202035-91202057 AAAAGTGCTAAAAGTGATATTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977864345 4:102005638-102005660 CATAATGCAAATAATAATAATGG - Intronic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979390657 4:120123355-120123377 CAAAATGCTAAAAAAGGGATAGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979740381 4:124142789-124142811 AAGCATGCTAATAGTGATATAGG + Intergenic
980388491 4:132117248-132117270 CAAAATATTAATAATAATATGGG + Intergenic
980693249 4:136322875-136322897 CAACTTACTAATAATGACATTGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982622105 4:157721493-157721515 GAAAATAATAATAATGATAATGG - Intergenic
982762231 4:159299075-159299097 CAAAACCCTGACAATGATATGGG + Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983607115 4:169600083-169600105 GAAAATGTTAAAAGTGATATTGG - Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984387162 4:179075844-179075866 TAAAATACTAATAAAGATATTGG - Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986382630 5:7202108-7202130 AAAAATGTTCAGAATGATATTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986538935 5:8823590-8823612 TTAAATGCAAATAATGATCTCGG - Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987110582 5:14682447-14682469 AAAAATGCTAATGATCATCTGGG - Intronic
987738225 5:21871944-21871966 CAAGTAGATAATAATGATATTGG + Intronic
987798205 5:22657211-22657233 CAAAATCATAATAGTGGTATTGG + Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988020200 5:25611292-25611314 AAAAATAATAATAATGATAATGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988085576 5:26471477-26471499 CAAATTGCTACAAAAGATATTGG + Intergenic
988319612 5:29676665-29676687 CCACATGCAAATAATGATATTGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990803380 5:59631130-59631152 CATAATGCAAATAAAGTTATTGG - Intronic
990933762 5:61123977-61123999 CAAAATTATAATAATTATTTGGG + Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991290425 5:65028761-65028783 GAAAATGCAATTAATGATCTTGG + Intergenic
992181592 5:74203094-74203116 CAAAACGCTATTAAAAATATTGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993082660 5:83320749-83320771 AAAAATGCTAATAATCATCTGGG - Intronic
993169035 5:84392924-84392946 CATAATGCTAATATTAAAATTGG + Intergenic
993368584 5:87063291-87063313 AAAAAAGCTAATAATCATCTTGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
994886290 5:105566014-105566036 CATAATTCTAAAAATGTTATAGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996191086 5:120542411-120542433 GAAAATGTTAATAGTGATAGAGG - Intronic
999715576 5:154357376-154357398 CAAAATGTTAATAGTGGTCTGGG + Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1000905006 5:166954941-166954963 TAAGATGCTAAAAATGATATGGG - Intergenic
1001874848 5:175191024-175191046 TAAAATGCACATAATCATATGGG - Intergenic
1002886630 6:1302463-1302485 AAAAATGCTAAAATTCATATGGG + Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004039267 6:11959807-11959829 CAAGATACTAATGATGATATAGG + Intergenic
1004064278 6:12227710-12227732 CAAGATGGTAATATTTATATCGG + Intergenic
1004112005 6:12727813-12727835 AAAAATATTAAAAATGATATTGG - Intronic
1004133816 6:12947136-12947158 CAAAATTATATTAATGATCTAGG - Intronic
1004796226 6:19088530-19088552 CAAAATGTTAATCACTATATAGG - Intergenic
1005144847 6:22677398-22677420 TAAAATGCTAAGAATTATCTGGG - Intergenic
1005512845 6:26527119-26527141 CAAAATACTAATAAAGCTTTGGG + Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007529166 6:42525687-42525709 CAAAATGTTAATATTGTTGTTGG - Intergenic
1008193587 6:48490950-48490972 CATAAAGCTACTAATGATAGAGG - Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008885758 6:56430492-56430514 TAAAATGCCAAAAATGATCTAGG - Intergenic
1008983730 6:57517288-57517310 CAAAATAATAATGATGTTATGGG + Intronic
1009171787 6:60410197-60410219 CAAAATAATAATGATGTTATGGG + Intergenic
1009215653 6:60917023-60917045 CAAAATGGGTATAATAATATTGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010020402 6:71153442-71153464 GAAAATGCAATTCATGATATAGG + Intergenic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1010396149 6:75394489-75394511 CAAAATAAAAATAATGAGATAGG + Intronic
1010532652 6:76988387-76988409 CATTTTGCTAATAATGATACAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010930050 6:81790829-81790851 TAAAATGGGAATAATGATACTGG + Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011830991 6:91371223-91371245 CAAAATGGTAATTATTATAATGG + Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012652068 6:101767357-101767379 CAAAATGTTTATAATGGTAATGG - Intronic
1012672442 6:102072044-102072066 CAAAGTGTGAATAATAATATGGG + Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012771209 6:103437243-103437265 CAGAATGCTAATAGAGACATAGG - Intergenic
1012930796 6:105314162-105314184 TAAAATGCTAATGATCATCTGGG + Intronic
1013240020 6:108236361-108236383 AAAAATAATAATAATAATATAGG - Intronic
1013827974 6:114238048-114238070 CAAAAAGATAATCATGATAGTGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014295242 6:119609553-119609575 CTAAATGTTAATAATGTTCTGGG - Intergenic
1014457258 6:121650258-121650280 CAAAATAGTAATAAGGATTTGGG + Intergenic
1014640882 6:123908861-123908883 CAAAATAGTAATTATGACATGGG - Intronic
1014939149 6:127417851-127417873 AAAAATGCTAATCCAGATATAGG + Intergenic
1015184315 6:130396220-130396242 GAAAATGCTAGTGATGATAGAGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015307477 6:131725841-131725863 AAAAATAATAATAATAATATTGG - Intronic
1015426392 6:133073723-133073745 CAAAATCCTCATCATGAAATAGG - Intergenic
1015652303 6:135477388-135477410 TAAAAAGCCAATAATGATAATGG - Intronic
1015915487 6:138212025-138212047 CAAAATGCTTAAAAAGATAAGGG + Intronic
1018059132 6:160076863-160076885 TAAAATCCTAATAAAGATGTTGG + Intronic
1018507937 6:164491483-164491505 CAAAATGCAAATGAAGATTTGGG + Intergenic
1018965248 6:168480400-168480422 GAAAATGTTAATAAAGATATAGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020579420 7:9976190-9976212 CAATATGCTAACATTAATATTGG - Intergenic
1020692730 7:11377379-11377401 CAAGATGTTATTAATGATATTGG + Intronic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024986029 7:55193825-55193847 CAGAAAGTTAATAATGCTATAGG - Intronic
1026456443 7:70576435-70576457 CAAAATGCAAGTGCTGATATGGG - Intronic
1026467405 7:70666207-70666229 CAAAATGGGAATAATGATAATGG + Intronic
1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG + Intronic
1027493756 7:78861653-78861675 CAAAATAAAAATAATGATAATGG + Intronic
1028360360 7:89960215-89960237 AAAAATGGTAATAATCTTATGGG - Intergenic
1028661048 7:93275502-93275524 AAAAATGCTAATAATCATCTGGG - Intronic
1028979542 7:96952221-96952243 CACAATGCTAATACTGTTAGGGG - Intergenic
1030146950 7:106366674-106366696 CAAAATGCCAAGGATAATATTGG - Intergenic
1030667321 7:112293766-112293788 CAAAATGGAACTAATTATATAGG + Intronic
1031180057 7:118402831-118402853 CAAGATGCTATTTATAATATCGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031808669 7:126338768-126338790 GAAAATGCTAAGAATCATTTTGG - Intergenic
1032936055 7:136732963-136732985 AAAAATGCTAAAATTCATATAGG + Intergenic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033410343 7:141111873-141111895 CAGAATGAAAATATTGATATAGG - Intronic
1033468878 7:141625062-141625084 AAAAATGCTAACAATTATCTAGG - Intronic
1033995582 7:147342238-147342260 CAGAATGTAAATAATGATAATGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035528364 8:332347-332369 AGAAATGCTAATCATGATCTGGG + Intergenic
1036737006 8:11328977-11328999 CCATATGCAAATAATGAAATTGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1036946155 8:13096809-13096831 CAGAGTGCTACTAATGAAATGGG + Intronic
1036966564 8:13305412-13305434 CAAAATGCTAATTTTTCTATTGG - Intronic
1036971340 8:13358696-13358718 AAAAATGCTAACAAAGATAAAGG + Intronic
1038384053 8:27124150-27124172 CAGAATGCTTTTAATGAGATGGG - Intergenic
1038469194 8:27798063-27798085 CCAAATGCTAGTGAGGATATGGG + Intronic
1038661439 8:29500788-29500810 AAAAATGCTATTATTAATATTGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039247803 8:35628888-35628910 TAAAATTATAATAATTATATAGG + Intronic
1039395438 8:37221522-37221544 CCAAATGCAAATAAGGAAATGGG + Intergenic
1039864891 8:41491582-41491604 CAAAATGGTCATCAGGATATAGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1042729487 8:71915935-71915957 CAAATTAATAATAATGAAATTGG - Intronic
1043002564 8:74777625-74777647 CAAAATAATATTAATGATATTGG + Intronic
1043576056 8:81657913-81657935 AAAAATAATAATAATGATAATGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044419122 8:91971210-91971232 AAAAATTATAATAATGATATAGG - Intronic
1044690430 8:94871486-94871508 AAAAATGATAATAATAATTTGGG + Intronic
1044928952 8:97233672-97233694 CCAAATACTAATAATGATAATGG - Intergenic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046270982 8:111898119-111898141 CAAAATACTAATAAGAAAATAGG + Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050088884 9:1995694-1995716 CAAGAGCCTAATAATGATTTTGG + Intergenic
1050218917 9:3363804-3363826 AAATATGGGAATAATGATATTGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051588848 9:18755341-18755363 CAACAAGCTACTAATAATATGGG - Intronic
1051769615 9:20562906-20562928 CAAAATGCAAAGAATGCTCTGGG - Intronic
1051770611 9:20574596-20574618 AAAAATGCTAATGATCATCTGGG + Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052366553 9:27618176-27618198 CAATATTCTAATAATGAAGTTGG + Intergenic
1052514912 9:29467844-29467866 CAAACTGCTAATAAAAATTTAGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1052778589 9:32757496-32757518 AAAAATGCCAAAAATCATATTGG - Intergenic
1053311163 9:37021037-37021059 GAAAATGCTAATAATAGTATGGG - Intronic
1053641494 9:40086194-40086216 TAAAATGATAATACTAATATTGG - Intergenic
1053744562 9:41181631-41181653 CAAAAAGAAAATAATGGTATGGG + Intronic
1053764642 9:41379280-41379302 TAAAATGATAATACTAATATTGG + Intergenic
1054322373 9:63683445-63683467 TAAAATGATAATACTAATATTGG - Intergenic
1054349831 9:64011524-64011546 CAAAAAGAAAATAATGGTATGGG + Intergenic
1054482709 9:65683579-65683601 CAAAAAGAAAATAATGGTATGGG - Intronic
1054543257 9:66290437-66290459 TAAAATGATAATACTAATATTGG + Intergenic
1054683783 9:68249619-68249641 CAAAAAGAAAATAATGGTATGGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055190450 9:73514897-73514919 AAAAATACAAATAATGAGATAGG + Intergenic
1055407250 9:75987794-75987816 CAAAATGATAAGAATGTAATGGG + Intronic
1056854471 9:90114007-90114029 GGAAATGCTAATAATTATCTTGG - Intergenic
1056878278 9:90360335-90360357 CAAAATTCCAAAAATGATTTTGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057507952 9:95651775-95651797 TAAATTGCTAATTATGTTATTGG + Intergenic
1058261006 9:102831630-102831652 AAAAATGCTAACAATCATCTAGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059148804 9:111927906-111927928 TGAAAAGCTATTAATGATATGGG - Intronic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1060935904 9:127515835-127515857 CAAAATAATAATAATAATAATGG + Intronic
1202789267 9_KI270719v1_random:69272-69294 TAAAATGATAATACTAATATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186060782 X:5703927-5703949 CAAAAAGCTCACAATTATATGGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188255605 X:27959209-27959231 CAAAATGCCAAAACTGAGATGGG - Intergenic
1188655580 X:32691188-32691210 TAAAATAGTAATCATGATATTGG - Intronic
1188726099 X:33584100-33584122 CAAAACTATAATAATGAGATGGG + Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190766580 X:53480569-53480591 CAATAAGGTAATATTGATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1191830496 X:65409955-65409977 AAAAATGCTAAAATTTATATAGG + Intronic
1192104439 X:68300361-68300383 CAAAATGCTAATAAAATTTTTGG - Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193945819 X:87732873-87732895 CAAAATGACAATAATGCTTTGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1196911004 X:120484382-120484404 GAAAATGCTAATATTGTAATGGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197671519 X:129283601-129283623 GAAAATCCAAAAAATGATATAGG - Intergenic
1198199832 X:134404808-134404830 AAAAATGCTAACAATCATCTGGG - Intronic
1198213937 X:134539315-134539337 CAAAATGCTACTAAAAAGATAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198626809 X:138584722-138584744 CAAAATGCTAATAATGCAAGCGG - Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199314269 X:146358765-146358787 TAAAATGCTAATAAAGTCATTGG - Intergenic
1199518579 X:148707831-148707853 CAAAATTCTAATGATGACATTGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1200946750 Y:8849005-8849027 GAAGATTTTAATAATGATATAGG + Intergenic
1201625790 Y:16012810-16012832 AAAAATGTTAAGAATGAAATTGG - Intergenic