ID: 984131358 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:175879139-175879161 |
Sequence | CAAAATGCTAATAATGATAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 645 | |||
Summary | {0: 1, 1: 18, 2: 60, 3: 120, 4: 446} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
984131358_984131361 | 4 | Left | 984131358 | 4:175879139-175879161 | CCCATATCATTATTAGCATTTTG | 0: 1 1: 18 2: 60 3: 120 4: 446 |
||
Right | 984131361 | 4:175879166-175879188 | AAGCCATTCACCAAGTCTCTAGG | 0: 12 1: 1552 2: 1888 3: 1395 4: 912 |
||||
984131358_984131363 | 7 | Left | 984131358 | 4:175879139-175879161 | CCCATATCATTATTAGCATTTTG | 0: 1 1: 18 2: 60 3: 120 4: 446 |
||
Right | 984131363 | 4:175879169-175879191 | CCATTCACCAAGTCTCTAGGAGG | 0: 1 1: 145 2: 152 3: 102 4: 137 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
984131358 | Original CRISPR | CAAAATGCTAATAATGATAT GGG (reversed) | Intronic | ||