ID: 984131358

View in Genome Browser
Species Human (GRCh38)
Location 4:175879139-175879161
Sequence CAAAATGCTAATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 18, 2: 60, 3: 120, 4: 446}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131358_984131363 7 Left 984131358 4:175879139-175879161 CCCATATCATTATTAGCATTTTG 0: 1
1: 18
2: 60
3: 120
4: 446
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131358_984131361 4 Left 984131358 4:175879139-175879161 CCCATATCATTATTAGCATTTTG 0: 1
1: 18
2: 60
3: 120
4: 446
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131358 Original CRISPR CAAAATGCTAATAATGATAT GGG (reversed) Intronic