ID: 984131359

View in Genome Browser
Species Human (GRCh38)
Location 4:175879140-175879162
Sequence CCAAAATGCTAATAATGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5208
Summary {0: 27, 1: 447, 2: 1520, 3: 1697, 4: 1517}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131359_984131361 3 Left 984131359 4:175879140-175879162 CCATATCATTATTAGCATTTTGG 0: 27
1: 447
2: 1520
3: 1697
4: 1517
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131359_984131363 6 Left 984131359 4:175879140-175879162 CCATATCATTATTAGCATTTTGG 0: 27
1: 447
2: 1520
3: 1697
4: 1517
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131359 Original CRISPR CCAAAATGCTAATAATGATA TGG (reversed) Intronic