ID: 984131361

View in Genome Browser
Species Human (GRCh38)
Location 4:175879166-175879188
Sequence AAGCCATTCACCAAGTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5759
Summary {0: 12, 1: 1552, 2: 1888, 3: 1395, 4: 912}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131354_984131361 27 Left 984131354 4:175879116-175879138 CCCCCTCAGTCTGAATTTCATTG 0: 2
1: 32
2: 506
3: 1219
4: 1746
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131357_984131361 24 Left 984131357 4:175879119-175879141 CCTCAGTCTGAATTTCATTGCCC 0: 1
1: 1
2: 66
3: 526
4: 1373
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131359_984131361 3 Left 984131359 4:175879140-175879162 CCATATCATTATTAGCATTTTGG 0: 27
1: 447
2: 1520
3: 1697
4: 1517
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131358_984131361 4 Left 984131358 4:175879139-175879161 CCCATATCATTATTAGCATTTTG 0: 1
1: 18
2: 60
3: 120
4: 446
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131355_984131361 26 Left 984131355 4:175879117-175879139 CCCCTCAGTCTGAATTTCATTGC No data
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912
984131356_984131361 25 Left 984131356 4:175879118-175879140 CCCTCAGTCTGAATTTCATTGCC 0: 1
1: 0
2: 2
3: 16
4: 237
Right 984131361 4:175879166-175879188 AAGCCATTCACCAAGTCTCTAGG 0: 12
1: 1552
2: 1888
3: 1395
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131361 Original CRISPR AAGCCATTCACCAAGTCTCT AGG Intronic