ID: 984131363

View in Genome Browser
Species Human (GRCh38)
Location 4:175879169-175879191
Sequence CCATTCACCAAGTCTCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 145, 2: 152, 3: 102, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984131357_984131363 27 Left 984131357 4:175879119-175879141 CCTCAGTCTGAATTTCATTGCCC 0: 1
1: 1
2: 66
3: 526
4: 1373
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131355_984131363 29 Left 984131355 4:175879117-175879139 CCCCTCAGTCTGAATTTCATTGC No data
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131354_984131363 30 Left 984131354 4:175879116-175879138 CCCCCTCAGTCTGAATTTCATTG 0: 2
1: 32
2: 506
3: 1219
4: 1746
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131359_984131363 6 Left 984131359 4:175879140-175879162 CCATATCATTATTAGCATTTTGG 0: 27
1: 447
2: 1520
3: 1697
4: 1517
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131358_984131363 7 Left 984131358 4:175879139-175879161 CCCATATCATTATTAGCATTTTG 0: 1
1: 18
2: 60
3: 120
4: 446
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137
984131356_984131363 28 Left 984131356 4:175879118-175879140 CCCTCAGTCTGAATTTCATTGCC 0: 1
1: 0
2: 2
3: 16
4: 237
Right 984131363 4:175879169-175879191 CCATTCACCAAGTCTCTAGGAGG 0: 1
1: 145
2: 152
3: 102
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984131363 Original CRISPR CCATTCACCAAGTCTCTAGG AGG Intronic