ID: 984133373

View in Genome Browser
Species Human (GRCh38)
Location 4:175905845-175905867
Sequence CTTTTTTTCTTAATGACGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 549}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984133373 Original CRISPR CTTTTTTTCTTAATGACGAA AGG (reversed) Intronic
901172909 1:7276180-7276202 TTTTTTTTTTTAATCATGAATGG - Intronic
902344376 1:15805238-15805260 GTTTTTTTCTTAATTAAAAAGGG + Intergenic
903309253 1:22440668-22440690 GTTTTTTTTTTAATCATGAAAGG + Intergenic
903352740 1:22727811-22727833 CTTTTTTTTTTAATGGAGATGGG + Intronic
904983959 1:34529452-34529474 ATTTTTTTCTTCATGACAACGGG + Intergenic
905468207 1:38171852-38171874 CCTTTTTTCTTGATCACAAATGG + Intergenic
906571486 1:46845550-46845572 GTTCTTTTCTAAATGACGGATGG + Intergenic
907235460 1:53042268-53042290 TTTTTTTTTTTAATGACTGAAGG + Intronic
907567250 1:55446923-55446945 CTTTTATTTTTAATGAAGACAGG - Intergenic
908607491 1:65814739-65814761 CTTTTTTTCTTATTGCTGTATGG + Intronic
908728971 1:67206681-67206703 TTTTTTTTTTTAATGGGGAATGG + Intronic
908936346 1:69381853-69381875 CTTTTTTTTTTAACTAGGAAAGG - Intergenic
909347975 1:74614850-74614872 CCTTTTGTCTTAATGATAAATGG + Intronic
909616142 1:77610757-77610779 TTTTTTTTTTTAATCATGAAGGG - Intronic
909851383 1:80468756-80468778 CAATTTTTCTTCATGATGAATGG + Intergenic
909919517 1:81363715-81363737 TTTTTTTTCCTAATAAAGAAAGG + Intronic
910029017 1:82693790-82693812 GTCTTTTTCTTAATGACTAATGG + Intergenic
910368447 1:86490515-86490537 GTTTTCTTCTAAATGAGGAAAGG - Intronic
910993352 1:93078768-93078790 ATTTTTTTCCTAACGATGAAAGG - Intergenic
911108176 1:94154274-94154296 TTTTCTTTTTAAATGACGAATGG + Intronic
911496829 1:98642051-98642073 CCTTTTTTCTTAATCGTGAAGGG - Intergenic
911809658 1:102259678-102259700 CTTTTTTGCTTGATAAAGAAAGG - Intergenic
912040149 1:105379721-105379743 TTTTTTTTTTTAATCATGAAGGG + Intergenic
913341301 1:117760316-117760338 TTTTTTTTCTTTGTGACAAAAGG - Intergenic
914690058 1:150017791-150017813 CCTTTTTTCTTTGTGACTAATGG + Intergenic
916346288 1:163795331-163795353 TTTTTTTTCTTTTTGACTAAGGG + Intergenic
916966996 1:169957929-169957951 CTTTTTTTCTTAAAGAGACAGGG + Intronic
917572165 1:176278931-176278953 TTTTTTTTTTTAATCATGAATGG + Intergenic
917667896 1:177243113-177243135 TTTTTTTTCTTATTTACTAATGG - Intronic
918256913 1:182757009-182757031 TTTTTTTTTTTAATGAGGCAGGG - Intergenic
918549701 1:185727930-185727952 CTTTTTTTTTTAATGAAGCCAGG - Intergenic
919064618 1:192677966-192677988 CTTTCATTCTTAATAAGGAAAGG + Intergenic
919120164 1:193329863-193329885 GTTTTTTTTTTAATCATGAAGGG + Intergenic
919382106 1:196872318-196872340 CATTTTTTTTTAATCACCAAAGG - Intronic
919427585 1:197451775-197451797 CTTTTCTTCTTAATGTCATATGG + Intronic
919518076 1:198551982-198552004 GTTTTTTTCTAAATAAAGAAAGG - Intergenic
919720741 1:200832047-200832069 CTTTTTTTCTAAATAACGCTAGG - Intronic
919831443 1:201543322-201543344 CATTTTTTTTTAATCACAAAGGG + Intergenic
920736745 1:208539738-208539760 CTTTTTCTTTTAATGCCAAATGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922069440 1:222176701-222176723 TTTTTTTTTTTAATCATGAAAGG - Intergenic
922094677 1:222433015-222433037 CTTTTTTCCTTCCTGAAGAAAGG - Intergenic
922848753 1:228713002-228713024 CTTTTTTTTTTAACCAGGAATGG + Intergenic
923508415 1:234627038-234627060 ATTTTATTTTTAATGAAGAAAGG + Intergenic
923673511 1:236061745-236061767 GATTTTTTTTTAATGACCAAAGG + Intronic
923797533 1:237172500-237172522 TTTTTTTTTTTAATGAGGAAAGG + Intronic
1062780176 10:196914-196936 CATTCTTTCTTCATGATGAAAGG - Intronic
1063536645 10:6890629-6890651 GTTTTTTTCTTACCGAAGAAGGG - Intergenic
1063633536 10:7758016-7758038 TTTTTTTTTTTAATGAGGACAGG + Intronic
1063711738 10:8485745-8485767 TTTTTTTTTTTTATGACGAGAGG - Intergenic
1064247459 10:13680423-13680445 CTTTTTTTTTTAATTTCCAAGGG - Intronic
1064294193 10:14063550-14063572 TTTTTTTTTTTAATGAGAAAAGG - Intronic
1064534947 10:16349184-16349206 CTTTTGCTCTGAATGAAGAAGGG + Intergenic
1064537782 10:16375816-16375838 CTTTTTTTTTTAAAGAAGAGTGG + Intergenic
1065061334 10:21904604-21904626 CTTTTTTTCTTAAGGATGCTGGG - Exonic
1065674640 10:28161527-28161549 TTTTGTTTCTTACTGACCAAGGG - Intronic
1065745824 10:28840762-28840784 CTTTTTTTGCTAATGATTAATGG + Intergenic
1065831354 10:29617162-29617184 CTCTTTTCCTTTATGAAGAAAGG + Intronic
1066204412 10:33173463-33173485 CTTTTTTTTTTAATGAGACAGGG - Intergenic
1070198149 10:74177536-74177558 CTTTTTTTGTTAATGAGGACAGG + Intronic
1070822247 10:79365890-79365912 TTTTTTTTTTTAATAATGAAAGG - Intergenic
1071537364 10:86445529-86445551 TTTTTTTTTTTAATGAGAAAGGG + Intronic
1072499341 10:95997394-95997416 CTTTTTTTTTTAATTAGGACAGG + Intronic
1074083205 10:110184299-110184321 CTTTTTTTTTTGAAGACTAACGG + Intergenic
1074263135 10:111874114-111874136 TTTATTTTCTTGATGAAGAAGGG + Intergenic
1074883477 10:117676676-117676698 TTTTTTTTCTTACTCACTAATGG + Intergenic
1075148554 10:119905126-119905148 CTTTTTTTTTTTCTGAGGAAGGG - Intronic
1077716694 11:4588322-4588344 TTTTTCTTTTTAATGGCGAAGGG - Intergenic
1078947954 11:16092841-16092863 TTTTTTTTTTTAATGAAAAAGGG - Intronic
1079784565 11:24655386-24655408 CTTTTTTTTTTAATAACTAGAGG + Intronic
1080271524 11:30455590-30455612 CTTTGTTTTTTAATGCCAAAAGG + Intronic
1080475803 11:32589860-32589882 CTTTTTTTCTAAAAAAAGAAAGG + Intronic
1080562283 11:33474908-33474930 CTTTTTTTGTTAATTAAGGAGGG + Intergenic
1080563501 11:33486172-33486194 CTTTTTTTCAAAACGACGAGAGG + Intergenic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1080984052 11:37440497-37440519 CTTTTTTTTTTAATTAAAAATGG + Intergenic
1081261133 11:40962293-40962315 CTTTCCTTCTAAATGATGAAGGG - Intronic
1081865877 11:46360477-46360499 TTTTTTTTTTTGATGAGGAAAGG - Intronic
1082931173 11:58607098-58607120 CCTTTCTTCTTCATGATGAAAGG - Intronic
1083495475 11:63048184-63048206 TTTATTTTCTTAATCATGAAAGG - Intergenic
1083977106 11:66131946-66131968 TTTTTTTTTTTAATGAGGAAGGG - Intronic
1086302750 11:85446051-85446073 CTCTTTTACTTAAAGAGGAAGGG - Intronic
1086359802 11:86046717-86046739 CTTTCTTTCTTAATAAAGACAGG + Intronic
1086671535 11:89553883-89553905 TTTTTTTTTTTAATGACAAGAGG + Intergenic
1087193014 11:95275674-95275696 CTTTCTTTTTGAATGAGGAATGG + Intergenic
1088343334 11:108794559-108794581 TTTTTTTTTTTAATCACAAATGG + Intronic
1088730344 11:112675743-112675765 CTGTTTGTTTTAATGATGAATGG + Intergenic
1089761741 11:120731261-120731283 TTTTTTTTTTTAATCATGAAAGG + Intronic
1089913820 11:122131639-122131661 CTTATTTTCTTATTGACTCAAGG - Intergenic
1090147482 11:124341006-124341028 CTTTTTTTCTTCATCCTGAATGG + Intergenic
1091246504 11:134100157-134100179 ATTTTTTTTTTAAGGAGGAAAGG - Intronic
1091505966 12:1068473-1068495 CTTTTTTTTTTAATTCCTAAAGG - Intronic
1093099338 12:15008696-15008718 GTTTTTTCCTTAATAATGAATGG + Intergenic
1093549889 12:20396113-20396135 CTTGTTTTCTAAATTACAAAAGG - Intronic
1093742676 12:22706338-22706360 CTTCTTTTCTCCATGAAGAAGGG + Intergenic
1093952491 12:25179732-25179754 TTTTTTTTTTTAATCATGAAAGG - Intronic
1094448352 12:30558026-30558048 CTTTTTTTTTTAATAACAGAGGG - Intergenic
1095179323 12:39129024-39129046 CTTTTTTTTTTGATAAAGAAAGG - Intergenic
1095258308 12:40067907-40067929 CTTTTTTTCTTGTTGAAGAAAGG + Intronic
1096293857 12:50366698-50366720 TTTTTTTTTTTAATAATGAAAGG - Intronic
1097504884 12:60454304-60454326 CTTTTTGTCTAGATGATGAAAGG - Intergenic
1098109642 12:67108469-67108491 TTTTTTTTCTTAGAGATGAAGGG + Intergenic
1099212848 12:79814507-79814529 ATTTTTTTTTTAATGAAGAGGGG - Intronic
1099336513 12:81366191-81366213 CTTATTTTTTTAAAGAAGAAAGG - Intronic
1099677063 12:85774667-85774689 ATTTTTTTCTTAATCGTGAAAGG + Intergenic
1100133265 12:91521999-91522021 TTTTTTTTCTTAAAGAAGTAGGG + Intergenic
1100211345 12:92401644-92401666 ATTTTTTTTTTAATGATGTAGGG - Intergenic
1100395889 12:94186069-94186091 ATTTTTTTCTTAAAGACACAGGG - Intronic
1100446790 12:94668456-94668478 TTTTTTTTTTTAATGAGGCAGGG - Intergenic
1100512313 12:95287643-95287665 CTGTTTTTCTTTATGACTCAGGG + Exonic
1101216316 12:102587911-102587933 TTTTTTTTCTTAATGATGCAAGG + Intergenic
1101402021 12:104396848-104396870 TTTTTCTGCTTAATGACCAATGG - Intergenic
1101624039 12:106421218-106421240 TTTTTTTTTTTAATGTCAAATGG - Intronic
1102757366 12:115353688-115353710 CTTTTTTGCTTAATTAAAAATGG + Intergenic
1103647668 12:122407790-122407812 CTTTTTTCCTTTGTGAAGAATGG - Intronic
1105276946 13:18939114-18939136 TTTTTTTTTTTAATGTAGAAAGG - Intergenic
1106052749 13:26206905-26206927 TTTTTTTTTTTAAGGAGGAAGGG - Intronic
1107628968 13:42323620-42323642 TTTTTTTTTTTAATTACTAATGG + Intergenic
1108111725 13:47081061-47081083 TTTTTTTTCTTAATGACTATGGG + Intergenic
1108627399 13:52244497-52244519 GTTTTTTTTTTAATCATGAATGG - Intergenic
1108658668 13:52561970-52561992 GTTTTTTTTTTAATCATGAATGG + Intergenic
1108682134 13:52789658-52789680 ATTTTTTTCTTCAGGAGGAATGG - Intergenic
1108874389 13:55026405-55026427 GTATTTTTCTTAATGACAGAAGG - Intergenic
1109367852 13:61380837-61380859 CTATTTTTTTTAATGGAGAAAGG + Intergenic
1109613849 13:64804394-64804416 CTTTTGTAATTAATGAAGAAAGG + Intergenic
1109778468 13:67075541-67075563 TTTTTTTTCTTAATTATGATGGG + Intronic
1110142194 13:72144155-72144177 CTTTTTTTTTAAATGAAGCAGGG + Intergenic
1110590451 13:77251044-77251066 ATTTTTTTCTTAAAGACCAGTGG - Intronic
1111969161 13:94892756-94892778 CTTTTTTTTTTTTTGAAGAAAGG + Intergenic
1112525960 13:100147262-100147284 CTTTTTTTCTTTTTAACCAAAGG + Intronic
1112745386 13:102521939-102521961 ATTTTTTTCTTACTGATAAAAGG - Intergenic
1112896907 13:104310623-104310645 TTTTTTTTTTTAATCAGGAATGG + Intergenic
1114175803 14:20318463-20318485 TTTTTTTTTTTAAAGACGGAGGG - Intronic
1114340781 14:21740918-21740940 CTTTTTTTCTTAATGGCTTCTGG + Intergenic
1114779613 14:25523425-25523447 CTTTTGTTATTAATCAAGAAAGG + Intergenic
1115673260 14:35640344-35640366 CTTTTTTTCTTAGTGGCCAAAGG - Intronic
1115841802 14:37480501-37480523 TTTTTTTTTTTAATCATGAAAGG - Intronic
1115857842 14:37650184-37650206 ATCTTTTTCTTGAGGACGAAGGG + Intronic
1115956120 14:38781327-38781349 TTTTTTTTTTTAATAATGAAAGG - Intergenic
1116089699 14:40289589-40289611 TTTTTTTTCTAAATGAGAAAAGG + Intergenic
1116256661 14:42565480-42565502 CTTTTTTTTTTAATAATGAGTGG + Intergenic
1116537756 14:46056736-46056758 CATTATTTCTTAATGGTGAAGGG + Intergenic
1116928385 14:50665647-50665669 TTTTGTTACTTAATGATGAAAGG - Intronic
1117125995 14:52626444-52626466 TTTTTTTTTTTAATCATGAAGGG - Intronic
1117709857 14:58516303-58516325 CTTTTGTTCTTAAAGGAGAAGGG - Intronic
1117942058 14:60978753-60978775 CTTTTGTTTTTATTGATGAAGGG - Intronic
1118100646 14:62597641-62597663 CTCTTTTTCTAAATGCCAAAAGG - Intergenic
1118512117 14:66486895-66486917 TTTTTTTTGTTAATTACTAAAGG + Intergenic
1118582521 14:67316756-67316778 ATTTTTTTTTTAATCAAGAAGGG - Intronic
1119575167 14:75713958-75713980 TTTTTTTTTTTAATTACAAAAGG + Intronic
1119823884 14:77641450-77641472 CTTTTTTTTATAATGAGGTAGGG - Intergenic
1120072127 14:80115493-80115515 CTTTTTATCTTCATGCCCAAGGG + Intergenic
1120228877 14:81821308-81821330 CTATTTTTCCTAATAACAAAGGG + Intergenic
1120228919 14:81821732-81821754 CTATTTTTCCTAATAACAAAGGG + Intergenic
1120529427 14:85614364-85614386 CTTTTTTTTTTAATTTCAAAGGG - Intronic
1120855033 14:89204854-89204876 CTTTTGTTCTCAATGATGGATGG - Intronic
1121356747 14:93222108-93222130 TTTTTTTTTTTAATGAAAAAGGG + Intronic
1121833978 14:97075854-97075876 TTTTTTTTTTTAATGAGGAAAGG + Intergenic
1122233324 14:100318257-100318279 CTTTTTATTTTTATAACGAAAGG - Intergenic
1124242495 15:28041310-28041332 TTTTTTTTTTTAATCATGAAAGG - Intronic
1124446793 15:29741750-29741772 CATTTTATCATAATGAGGAAAGG - Intronic
1124528635 15:30482559-30482581 ATATTATTCTTAATGTCGAAAGG - Intergenic
1124770021 15:32525138-32525160 ATATTATTCTTAATGTCGAAAGG + Intergenic
1124825337 15:33088838-33088860 CATTTTTGCTTCATGAGGAAAGG - Exonic
1125024635 15:35018483-35018505 GTTTTTTTCTTAGTAAGGAATGG + Intergenic
1125735324 15:41921091-41921113 CTTGTTTTCTTTATGAAAAATGG - Intronic
1126160139 15:45604195-45604217 CTTTTTTTCTTAATAGAGATGGG - Intronic
1126311964 15:47327679-47327701 ATGTTTTCCTTAATGAGGAAAGG - Intronic
1126375517 15:47993041-47993063 TTTTTTTTTTTAATGGAGAAAGG + Intergenic
1126396292 15:48221573-48221595 ATTTTTTTCTAAATGAAAAATGG + Intronic
1126437963 15:48655246-48655268 CTTATTTTCCTAAAGAGGAAAGG - Intergenic
1127750842 15:62041127-62041149 CTTCTTTTTTTTATGACAAAAGG - Intronic
1127778137 15:62285046-62285068 ATTCTTTTCTTAATGACATAAGG + Intergenic
1128436111 15:67650519-67650541 TTTTTTTTTTTAATTATGAAAGG + Intronic
1130166312 15:81462712-81462734 CTTTTTTTTTTTATCATGAAGGG + Intergenic
1130294656 15:82636969-82636991 GTTTTTTTATTGATGAAGAATGG - Intronic
1130766423 15:86876048-86876070 CTCTTATTCTTAGTGACAAAAGG - Intronic
1130977245 15:88786562-88786584 TTTCTTTTCCTAATGACTAATGG - Intergenic
1131055754 15:89373459-89373481 CTTTTTTTTTTAAGTACCAAGGG - Intergenic
1131501418 15:92970649-92970671 CTTTTTTCCTTAATGATACATGG + Intronic
1131672767 15:94637728-94637750 TTTTTTTTTTTAATGAGGGATGG - Intergenic
1131923388 15:97354681-97354703 TTTTTTTTCTTAGAGACGGACGG - Intergenic
1132253673 15:100354819-100354841 TTTTTTTTTTTAATCAGGAACGG - Intergenic
1133815997 16:9197948-9197970 TTTTTTTTTTTAATGACACAGGG + Intergenic
1134745417 16:16584400-16584422 CTGTTCTTCTTAGTGAAGAAAGG - Intergenic
1135731699 16:24900062-24900084 GTTTTTTTCTTAATGTGGTAAGG + Intronic
1135800599 16:25490610-25490632 TTTTTTTTTTTAATCATGAATGG + Intergenic
1137321278 16:47385766-47385788 CTTTCTTTTTTAATGTCAAAGGG + Intronic
1138227679 16:55311714-55311736 TTTTTTCTCTTAATGACCATGGG - Intergenic
1138500838 16:57443048-57443070 CTGTTTTCCTTAATGACAGAGGG + Intronic
1139023780 16:62787499-62787521 CTTTTTTTCTTAGTGTCTTAAGG + Intergenic
1140854883 16:78969275-78969297 TTTTTTTTCTTTTTGAGGAAGGG + Intronic
1140998374 16:80283744-80283766 TTTTTTTTTTTAATCATGAAAGG - Intergenic
1144039425 17:11396077-11396099 GTTTTTTTATTAATCAAGAATGG + Intronic
1145054142 17:19688310-19688332 TTTTTTTTTTTAATCATGAAGGG - Intronic
1146175732 17:30665148-30665170 TTTTTTTTTTTAATGAAGACAGG + Intergenic
1146826860 17:36030619-36030641 TTTTTTTTTTTAATAAGGAAAGG - Intergenic
1147000181 17:37356726-37356748 TTTTTTTTCTGAATTACAAAAGG + Intronic
1147195017 17:38760652-38760674 ACTTTTTTCCTAATGACCAAGGG - Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1147735303 17:42633648-42633670 CTTTTTTTCTTTTTGAAGACGGG - Intergenic
1148549046 17:48539258-48539280 TTTTTTTTTTTAATGACTCAGGG + Intergenic
1149102743 17:52925822-52925844 CTTTTTTTCATAGTGAGAAAAGG - Intergenic
1149797732 17:59536218-59536240 CTATTTTTTTTAATGAAGAAAGG - Intergenic
1149906891 17:60534785-60534807 CTTGTTTTATAAATGACTAAGGG - Intergenic
1153159244 18:2184382-2184404 CTTTCTTTCTGAAAGATGAAGGG - Intergenic
1153445720 18:5170677-5170699 CTCTGTTTCTTGATGAAGAATGG - Intronic
1153753272 18:8255612-8255634 CTTTTTTTTTAAATGAACAATGG - Intronic
1153861294 18:9210761-9210783 TTTTTTTTTTTATTGAGGAAAGG + Intronic
1153902167 18:9627092-9627114 CTTTTTTTTTTAATTACTAGAGG + Intergenic
1154436668 18:14348695-14348717 CTTTTTATCATAATAAAGAATGG - Intergenic
1157509272 18:48257849-48257871 GTTTTTTTCTTAATCAGAAATGG - Intronic
1157902050 18:51527468-51527490 CTCTTTTTCTTCTTGACGACAGG + Intergenic
1159225442 18:65528386-65528408 CTTTTCTTTTTAATGACTGAAGG - Intergenic
1159469605 18:68834811-68834833 CTTTTTTTCCCAATGATTAAAGG + Intronic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1161221876 19:3121657-3121679 CTTCTTTTCTTCATCACAAAAGG + Exonic
1163240523 19:16060196-16060218 CTTTTTTTCTTAAAGAGACAGGG - Intergenic
1163323276 19:16586918-16586940 TTTTTTTTTTTAATGCAGAATGG + Intronic
1164588430 19:29492260-29492282 CTTTTCTTTTTAATCATGAATGG + Intergenic
1164663132 19:29996798-29996820 TTTTTTTTTTTAATCATGAAAGG + Intronic
1165020150 19:32917558-32917580 TTTTCTTTCTTAGTGAAGAATGG - Intronic
1165572439 19:36786626-36786648 CTTTTTGGCTTAATTACCAAAGG - Intergenic
1166610330 19:44186877-44186899 TTTTTTTTTTTAATCATGAAAGG + Intergenic
1167118796 19:47504080-47504102 CTTTTTTTTTTAAACACAAATGG - Intronic
1167540471 19:50083858-50083880 CTTTTTTTGTTTTTGACAAAGGG + Intergenic
1167639713 19:50674099-50674121 TTTTTTTTTTTAATGCAGAAGGG + Intronic
1168417562 19:56178642-56178664 CTTTTTTTCTATATAACTAAGGG + Intronic
924981964 2:231418-231440 CTTTTTATATTAATAAAGAAAGG - Intronic
925522534 2:4763037-4763059 CTTTTTTTCTCAAGGAGAAAAGG + Intergenic
925661360 2:6206484-6206506 CTTATGTTCTTATTTACGAATGG - Intergenic
926174875 2:10581844-10581866 CTTTTTTTCTTTAACATGAATGG - Intronic
926378720 2:12262432-12262454 CTTTTTTTCTTATGAATGAATGG + Intergenic
926517444 2:13866385-13866407 TTTTTTTTCCTAATGACTCATGG + Intergenic
927317896 2:21706881-21706903 CTTTTTTACCTAAGGACAAATGG - Intergenic
927608383 2:24510350-24510372 CTTTTTTTCTTAAAGGAGACGGG + Intronic
927729487 2:25458368-25458390 CTTTTTTTCTAAATGGGAAAAGG + Intronic
928411690 2:31059234-31059256 GTTTTTTCATTAATGACAAATGG - Intronic
928471195 2:31578206-31578228 CATTTTTTCCTAATGAAAAATGG - Intronic
928677595 2:33664476-33664498 CTTTTTTGCTAAATGACTTATGG + Intergenic
928865796 2:35916319-35916341 TTTTGTTTTTTAATGACAAAAGG + Intergenic
929969736 2:46563822-46563844 CTCTTTTTCTTAATGGAGACAGG + Intronic
930678773 2:54233044-54233066 TTTTTTTTTTTAATCATGAATGG + Intronic
930817673 2:55616271-55616293 CTTTTGTTCTTAATGAGGAAAGG - Intronic
931344989 2:61438303-61438325 GTTTTTTTTTTAATCACGAATGG - Intronic
931526209 2:63157052-63157074 TTTTTTTTTTTAATTATGAATGG + Intronic
931667520 2:64620737-64620759 ATTGTTTTCTTATTGTCGAAGGG - Intergenic
931776458 2:65545328-65545350 TTTTTTTTTTTAATGGAGAAAGG - Intergenic
931845750 2:66202301-66202323 TTTTTTTTTTTAATGAAAAAAGG + Intergenic
932195444 2:69779157-69779179 CTTTTTTTTTTAATGAAATAAGG + Intronic
932550174 2:72761358-72761380 CTTTGTTTCTTAGTGATGATTGG - Intronic
933601374 2:84334886-84334908 GTTTTTTTTTTAATCATGAAGGG - Intergenic
933907450 2:86909090-86909112 TTTTTTGTCTTAATTATGAAAGG + Intronic
933908696 2:86918782-86918804 TTTTTTGTCTTAATTATGAAAGG + Intronic
934024027 2:87984603-87984625 TTTTTTGTCTTAATTATGAAAGG - Intergenic
934489318 2:94748814-94748836 CTTTGTATCATAATGAAGAATGG + Intergenic
935426270 2:102921307-102921329 TTCTTCTTCTTAATGAAGAAAGG + Intergenic
936074297 2:109391843-109391865 CTTTTTTTTTTAATTAAGACAGG + Intronic
936364677 2:111842316-111842338 TTTTTTGTCTTAATTATGAAAGG - Intronic
936907829 2:117557398-117557420 CTTTTTTACTTAATTAAAAATGG - Intergenic
936950060 2:117968784-117968806 TTTTTTTTCTTTATGAAGAGAGG - Intronic
937020841 2:118653074-118653096 CTTTTTTTTTTAATTAGGTATGG + Intergenic
937173965 2:119907597-119907619 TTTTTTTTCTTAATAGAGAAAGG - Intronic
937194367 2:120138157-120138179 TTTTTTTTCTTAATCACAAAGGG - Intronic
937305590 2:120868597-120868619 CTTTGTTTCTGAATGGCAAAGGG - Intronic
937374039 2:121323093-121323115 ATTTTTTTCTTATTGAAGTAGGG + Intergenic
937966914 2:127519359-127519381 GTTTTTTTTTTAATAACTAAAGG + Intronic
939733729 2:145817645-145817667 TTTTTTTTCTAAATGAGAAAAGG - Intergenic
940462311 2:153980836-153980858 CTTTGTTTCTTAAAGCCGTAAGG + Intronic
942920733 2:181370412-181370434 CTTTTTCTCTTTAGGATGAATGG - Intergenic
943371187 2:187018083-187018105 ATTTTATTCTTAATGATGTAGGG - Intergenic
944290169 2:197995871-197995893 CTTTCTGTCTTAGTGACAAATGG + Intronic
944874949 2:203953536-203953558 CTTATTTTCTTAATGACCCTGGG - Intronic
945495639 2:210504259-210504281 TTTTGTTTCTTAATGAAGATGGG - Intronic
945671355 2:212806138-212806160 CTTTTTTTCTTAGTGGCAGAAGG - Intergenic
945728094 2:213498319-213498341 CTTATTTTTTTTATGATGAATGG + Intronic
945861755 2:215130936-215130958 GTTTTTTTTTTAATCACGAAAGG + Intronic
946263238 2:218514634-218514656 CTATATTTCTTAATTACAAAAGG - Intronic
947463488 2:230322655-230322677 CATTTTCTCTTACTGACTAAGGG - Intergenic
947759359 2:232592518-232592540 GTCTTTTTCTTATTGACTAACGG + Intergenic
948085737 2:235245520-235245542 TTTTTTTTTTTAATGACAAGAGG + Intergenic
948157344 2:235793950-235793972 TTTTTTTTATTATTGAAGAATGG + Intronic
948442872 2:238007519-238007541 ATTTTTTTTTTAATCATGAATGG + Intronic
949073693 2:242041622-242041644 CTTTATTTCTTAGTGTCGAGTGG - Intergenic
1169956159 20:11105251-11105273 CTTTGTTTTATAATGATGAAAGG + Intergenic
1170186773 20:13599779-13599801 TTTTTTTTTTAAATCACGAATGG - Intronic
1170487942 20:16838906-16838928 CCTTTTAGCTTAATGACAAAAGG + Intergenic
1170917701 20:20643844-20643866 CTTTTTTTTTTAATCTCTAAAGG + Intronic
1171027701 20:21646740-21646762 TTTTTTTTTTTAATCATGAAAGG - Intergenic
1172669167 20:36622432-36622454 TTTTTTTTTTTAATCATGAAGGG - Intronic
1174066651 20:47870656-47870678 CTTTTTTTTTTTCTGACTAAAGG + Intergenic
1174831378 20:53815520-53815542 TTTTTTTTTTTAATCATGAAGGG + Intergenic
1174870827 20:54180254-54180276 TTTTTTTTCTCAAAGATGAAAGG - Intergenic
1176840373 21:13836960-13836982 CTTTTTATCATAATAAAGAAGGG + Intergenic
1177014379 21:15766610-15766632 CTTTTTTTCTTTTGGATGAAAGG - Intronic
1177193577 21:17879200-17879222 ATTTTTTTCTTAATGTTGCATGG + Intergenic
1177484630 21:21741264-21741286 CATTTTCTCATAATGAAGAAAGG - Intergenic
1177728805 21:25001422-25001444 TTTCTTTTCTTAATGTCCAATGG - Intergenic
1177975991 21:27851004-27851026 TTTTTTTTTTTAATGTCTAAGGG + Intergenic
1178616436 21:34137785-34137807 TTTTTTTTTTTAATCAGGAATGG + Intronic
1178768210 21:35475303-35475325 TTTTTTTTCCTAAAGAAGAAAGG - Intronic
1179168869 21:38957448-38957470 ATTTATTTTTTAATGATGAAAGG - Intergenic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
1184121966 22:42457351-42457373 TTTTTTTTTTTAATTATGAATGG + Intergenic
1184237390 22:43190556-43190578 TTTTTTTTCTTTTTGAGGAAGGG + Intergenic
949154017 3:807640-807662 TTTTTTTTCTAAATGAGAAATGG + Intergenic
949528208 3:4927365-4927387 CTTTCATTTTTAATGACAAAAGG + Intergenic
949796054 3:7852274-7852296 CTTTTTGTCTTAATTTCAAATGG + Intergenic
950814062 3:15680111-15680133 ATTTTTTTCTTAATGGCAATGGG + Intronic
951675336 3:25233769-25233791 TTTTTTTTTTTAATCATGAATGG + Intronic
952200953 3:31126788-31126810 CTTATTTTCTTAATGAGTGAAGG - Intergenic
952430628 3:33219344-33219366 TTTTTTTTTTTAATGAAGAGAGG + Intergenic
953496888 3:43395015-43395037 CTTTTTCTCCTAGTGAAGAAAGG + Intronic
953955822 3:47231212-47231234 TTTTTTTTCTCAATCATGAAGGG - Intronic
954477587 3:50762716-50762738 GTTTTTTTTTTAATCATGAAAGG + Intronic
955556174 3:60139809-60139831 TTTTTTTTTTTAATAATGAAAGG - Intronic
955870219 3:63430769-63430791 TTTTTTTTCTTTCTGAAGAATGG + Intronic
956073476 3:65479610-65479632 CTTTTTTTCTTAAATTCTAAAGG - Intronic
956112295 3:65881619-65881641 CTTTTTTTTTTTTTGAGGAAGGG - Intronic
957207840 3:77220811-77220833 CTTTTTTTCAAAAAGATGAATGG - Intronic
957894836 3:86408651-86408673 CTTGTTGTCTAAATGAAGAAAGG + Intergenic
958051888 3:88358527-88358549 GTTTTTTTTTTAATCATGAAAGG + Intergenic
958076207 3:88682626-88682648 CTTTTATTCTAAATGACTAGTGG - Intergenic
958455359 3:94324396-94324418 CTTTCTTTCTGAATGATTAAGGG - Intergenic
959163379 3:102745701-102745723 GTTCTTTTCTTAATGTCTAATGG + Intergenic
959179130 3:102956182-102956204 CTTTTTTTCTCCATGAAAAAAGG + Intergenic
959728599 3:109574246-109574268 CTTTTTTTTTTAATGAGACAGGG + Intergenic
959806921 3:110565908-110565930 CTTTTTTTCTTAAAGATCATAGG + Intergenic
959889751 3:111541248-111541270 CTTGTTTTCTTAATGTTGGAGGG + Intronic
960101066 3:113744455-113744477 TTTTTTTTTTTAATGAGGCAGGG - Intronic
960315236 3:116168227-116168249 ATTTTTTTTTTACTGACCAATGG + Intronic
960822927 3:121753151-121753173 TTTTTTTTTTTAATCATGAATGG - Intergenic
961101074 3:124199619-124199641 CCTTTTTTCTTAAAGAGTAAAGG + Intronic
961213084 3:125140724-125140746 TTTTTTTTCTTAAAGAGGCAGGG + Intronic
962788598 3:138790439-138790461 TTTTTTTTTTTAATGAGGACAGG - Intronic
963089836 3:141473020-141473042 GTTTTTTTTTTAATCATGAAGGG + Intergenic
963116598 3:141735642-141735664 CTTATTTTGTTAAAGATGAATGG + Intergenic
963621875 3:147619926-147619948 CCTTTTTTCTTAATCACGAAAGG + Intergenic
963944200 3:151127618-151127640 ATTTTTTTCTTAATGAAAATTGG + Intronic
964208889 3:154206504-154206526 CTTTTTGTGTTAATTATGAATGG - Intronic
964249620 3:154697573-154697595 TTTTTTTTCTTAGTAAGGAATGG + Intergenic
964291143 3:155181907-155181929 CTTTTTTTTTTAAAGGCAAATGG - Exonic
964591997 3:158375372-158375394 TTTTTTTTCTTAATGAGATATGG + Intronic
964610252 3:158606422-158606444 CATTTTATTTTAATGACTAAAGG - Exonic
964689806 3:159437622-159437644 TTTTTTTTTTAAAAGACGAATGG - Intronic
964744267 3:159997628-159997650 CTTTTTCTATTAAGGAGGAATGG - Intergenic
964775413 3:160270573-160270595 TTTTTTTTCTGAAAGACGTAAGG - Intronic
964939204 3:162134054-162134076 CTTTTTTTCTAAATGGGAAAAGG - Intergenic
964997571 3:162903709-162903731 CTTTTTATTTTTATGAAGAAGGG - Intergenic
965004925 3:163008242-163008264 CTTTTTTTCTTATTGAGACAGGG - Intergenic
965321338 3:167255296-167255318 TTTTTTGTCTTATTGCCGAATGG - Intronic
965380830 3:167985827-167985849 GTTTTTTTTTTAATCATGAAGGG - Intergenic
965447753 3:168796973-168796995 CTTTTTTTTTTAATGCCCTAAGG + Intergenic
965486875 3:169288955-169288977 CTTTTTTTATGAAAGACAAAAGG + Intronic
967535484 3:190597324-190597346 CTTTTTTTGTTAATCAAGATAGG + Intronic
968094924 3:195922230-195922252 ATTTTTTTCTTAATGCAGTAGGG + Intergenic
968718893 4:2184283-2184305 CTTTTTGTCTGAATGTCCAAAGG - Intronic
969973465 4:11072476-11072498 TTTTTTTTTTTAATGACTGAAGG - Intergenic
970674217 4:18430530-18430552 TTTTTTTTCTTAATGCTTAATGG + Intergenic
971137730 4:23888265-23888287 ATTTTTTTCTTAAGGAGGAAAGG - Intronic
971525785 4:27616836-27616858 CTTGTTTCCTAAATGAAGAAGGG + Intergenic
972130361 4:35825426-35825448 TTTTTTTTTTTAACAACGAAAGG + Intergenic
972695316 4:41439575-41439597 CTTTTTTTTTTAATGAGACAGGG - Intronic
972937739 4:44159382-44159404 ATTTTTTTCTTAAGGACAATGGG - Intergenic
973112923 4:46417330-46417352 TTTTGTTTTTTAATGAAGAAAGG - Intronic
974108995 4:57504699-57504721 CTTGTCTTCTTAATGCCGAAAGG - Intergenic
974290577 4:59924650-59924672 TTTTTTTTCTAAATGAGAAAAGG - Intergenic
974634826 4:64547879-64547901 TTTTTTTTTTTAATGACTACTGG + Intergenic
976243626 4:82985890-82985912 CTTTTTTTCTTCATGGGGATTGG - Intronic
977042654 4:92033911-92033933 CTTGTTTTCTTAAAGTCTAAAGG - Intergenic
977407456 4:96618036-96618058 CTTTTCTTTTTAATCACAAAGGG + Intergenic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
977788701 4:101072260-101072282 TTTCTTTTCTTATTGAAGAATGG + Intronic
978041864 4:104075145-104075167 CTTTTTTTCTTAGTCACGTTGGG - Intergenic
978281548 4:107021955-107021977 CATTTTCTGTTAATGAGGAAAGG + Intronic
978691664 4:111520054-111520076 CTTTTTTTCTTTATTAGGAGAGG + Intergenic
978949042 4:114534997-114535019 CTTTTTTTCTTTTTAAAGAATGG - Intergenic
978977775 4:114899532-114899554 TTTTTTTTTTTAATCATGAATGG + Intronic
979788305 4:124745353-124745375 CTATTTTTCTAAGTGACAAAAGG - Intergenic
979807860 4:124996901-124996923 TTTTTTTTTTTAATGAGGCAGGG - Intergenic
980023022 4:127731390-127731412 CTTTTTATCTTGATGACTGAGGG - Intronic
981108714 4:140911052-140911074 ATTTTTTTCTTTTTGAGGAAAGG + Intronic
981126295 4:141110582-141110604 AATTTTTTTTTAATGAGGAAGGG + Intronic
981399613 4:144298411-144298433 CATTTTTGCTAAATGAAGAAAGG + Intergenic
981481782 4:145245965-145245987 ATTATTTTCTAAATGAGGAAAGG - Intergenic
982038183 4:151367708-151367730 TCTATTTTCTTAATGATGAAAGG + Intergenic
982259525 4:153482181-153482203 GTTTTTTTCTTAAAGAGGATGGG + Intronic
982387915 4:154832757-154832779 CTTTTTTTGTGGATGATGAAAGG + Intergenic
982634906 4:157882705-157882727 TTTTTCTTCTTAATGAAGATAGG - Intergenic
983382713 4:167017973-167017995 ATTTTTTTCTTTCTCACGAAGGG + Intronic
983856809 4:172657014-172657036 CTTTTTCTCTTACTAATGAAAGG - Intronic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
984199570 4:176700834-176700856 GTTTTTCTGTTAATGACGTATGG - Intronic
984368272 4:178827288-178827310 ATTTTTTTCTTATTGACTAGTGG - Intergenic
984962029 4:185107031-185107053 CTTTTATTCTTAATGCCAACAGG + Intergenic
985124374 4:186677492-186677514 TTTTTTTTTTTAATGAAGAACGG + Intronic
985433930 4:189909711-189909733 CTTTTTTTCTTAATGTAGCTAGG + Intergenic
986998463 5:13634219-13634241 CCATTTTTCTTAATGAAGATTGG - Intergenic
987087697 5:14485675-14485697 CTTATTTTTTTAATGGGGAAAGG - Intronic
987098603 5:14572613-14572635 CTTTTCCTCATAATGACCAAAGG + Intergenic
988194290 5:27981831-27981853 CATTTCTTCTTCATGAGGAAAGG + Intergenic
988234359 5:28521723-28521745 TTTTTTTTCTTTATCATGAAGGG - Intergenic
988633336 5:32954767-32954789 CATTTTTTCTTCATTACTAATGG + Intergenic
988700427 5:33668508-33668530 TTTTTTTTCTTTATGAGGCAGGG + Intronic
989185238 5:38618170-38618192 GTTTATTTCATAATGATGAAGGG - Intergenic
989265129 5:39464629-39464651 GTTTTTATCTTAAGGACAAAGGG - Intergenic
989661337 5:43801489-43801511 CTTTTTTACTTAAGGACTCATGG + Intergenic
989963098 5:50439496-50439518 TTTTTTTTTTTAATAAAGAAGGG + Intronic
990039751 5:51364546-51364568 CTTTTTTTATTAATTAGCAAAGG + Intergenic
990382149 5:55228496-55228518 CTTTTTTTCCTAAAGACCTAGGG - Intergenic
991267333 5:64736800-64736822 TTTTTTTTCCTAATGATAAAAGG - Intronic
993563710 5:89445604-89445626 CTTTGTTTCTTTATCACTAATGG - Intergenic
994217467 5:97154116-97154138 GTTTTTTTTTTAATCATGAAGGG + Intronic
994433142 5:99694660-99694682 CCTTTTTTCTTAATAATTAACGG - Intergenic
994522087 5:100852432-100852454 TTTTTTTTTTTAATAAAGAATGG - Intronic
994844560 5:104970595-104970617 ATTTTCTTCTAAATGATGAAAGG + Intergenic
996871124 5:128194346-128194368 ACTTTTTTCTTCATGACAAACGG + Intergenic
997156103 5:131559821-131559843 CTTTTTTTCTTAAAGAAAAGGGG - Intronic
998221195 5:140281863-140281885 CTTTTTTTTTTAATGAGACAGGG - Intronic
998288562 5:140888754-140888776 CTTTTTTTTTTAATTTTGAAGGG + Intronic
999761440 5:154704158-154704180 CTTTTTTTCTAAATGAGAAATGG + Intergenic
1000507334 5:162137567-162137589 TTTTTTTTCTCAATGACAAATGG + Intronic
1000512582 5:162202055-162202077 CATTTTTTCTTGATGGAGAATGG + Intergenic
1000630651 5:163587000-163587022 CTCTTTTTCCTCATGAAGAAGGG + Intergenic
1000901707 5:166919192-166919214 TTTTTTTTTTTAATCAAGAATGG - Intergenic
1001500982 5:172233995-172234017 CTTTTTTTTTTAATGTAGCAAGG - Intronic
1001720270 5:173851452-173851474 CTTTTTTTCTTAATGGCCACAGG - Intergenic
1003219833 6:4149816-4149838 GTTTTTTTTTTTATCACGAAGGG + Intergenic
1003432712 6:6054797-6054819 CTTTTTTTCTTCACAAGGAAAGG - Intergenic
1004268426 6:14171248-14171270 GTTTTTTTTTTAATCATGAAAGG - Intergenic
1004293257 6:14387475-14387497 GTTTTTTTTTTAATAAGGAAAGG + Intergenic
1004791917 6:19035916-19035938 CTTTTTTGCTTAATACCAAATGG - Intergenic
1005125460 6:22442014-22442036 CCTTTTTTCTTAATAGCTAAGGG - Intergenic
1006278458 6:33026378-33026400 GTTTTTTTTTAAATCACGAAAGG + Intergenic
1006769128 6:36536849-36536871 TTTTTTTTTTTAAAGAAGAAAGG + Intronic
1008018140 6:46544766-46544788 TTTTTTTTTTTAATCATGAAGGG - Intergenic
1008612257 6:53195345-53195367 CTTTTTTTCTTAATAGAGACAGG - Intergenic
1008641681 6:53469521-53469543 ATTTTTTTTTTAATCATGAAGGG + Intergenic
1008941426 6:57050000-57050022 CTTTTTTTTTTAATGAGGTAGGG + Intronic
1008987226 6:57559121-57559143 TTTTTTTTCTTTAAGACGCAGGG - Intronic
1009000990 6:57714673-57714695 GTTTTTTTTTTAATGTCCAAAGG - Intergenic
1009824689 6:68852273-68852295 CTTTTATTCTTAATTAGTAAGGG + Intronic
1010137179 6:72569311-72569333 CTTTTTTTTTTAATCATAAATGG - Intergenic
1010212473 6:73372918-73372940 TTTTTTTTTTTAAAAACGAAAGG + Intronic
1010425429 6:75723851-75723873 TTTTTTTTCTTTATGAAGAAAGG + Intergenic
1010948589 6:82007533-82007555 CATTTTTTTTTAATCATGAAGGG - Intergenic
1010991258 6:82482766-82482788 ATTTTTTTCTAAATTAGGAATGG + Intergenic
1012516549 6:100068212-100068234 CTTTTTTTCTAAATGGGAAAAGG - Intergenic
1013019204 6:106195051-106195073 CTTTTTTTGTAAATGGCTAAGGG - Intronic
1013643680 6:112113677-112113699 CATTTTTTCCTACTGAGGAAGGG + Intronic
1014171624 6:118285237-118285259 CTGGTTTTCTTTATGACGACTGG - Exonic
1014364002 6:120517672-120517694 ATTTTTTTCTTAATGGTAAAAGG - Intergenic
1014386611 6:120810762-120810784 GTTTTTTTTTTAATCATGAAAGG - Intergenic
1014910417 6:127085933-127085955 CTTTTTTTCTTTCTGAACAATGG - Intergenic
1015112136 6:129604773-129604795 CTTTTTTTCTGATTTAGGAAAGG + Intronic
1015705957 6:136087985-136088007 CTTTTTCTCTAAATCACGTAAGG + Intronic
1015833554 6:137395106-137395128 CTTTTTTTTTTAATGGAGACAGG - Intergenic
1016096094 6:140039431-140039453 CTCTTTTTTTTAATGCCTAAAGG + Intergenic
1016219469 6:141649107-141649129 TTTTTTTTCTGAATGATGTATGG - Intergenic
1018401666 6:163427757-163427779 CTTTGTATCTTAAGCACGAAGGG + Intronic
1018753659 6:166829799-166829821 CTTTTCTTCTTAAGGCTGAACGG - Intronic
1020485855 7:8719473-8719495 GTTGTTTTCTTAATGACATATGG - Intronic
1020576636 7:9939907-9939929 CTTTATTTCTTAATTACTATTGG - Intergenic
1020577198 7:9947904-9947926 ATTTTTTTCTGAATGACCACTGG - Intergenic
1020767985 7:12349317-12349339 CTTTTTTTCTTCCAGATGAATGG - Intronic
1021211899 7:17863829-17863851 CTCTTTCTCTTAATTACAAAGGG - Intronic
1022250699 7:28605033-28605055 CTCTTTTTTTTAATGAGAAAGGG - Intronic
1022348601 7:29543758-29543780 CTTTTTTTTTTAATCATGAAGGG - Intergenic
1022534681 7:31089431-31089453 TTTTTTTTTTTAATCAGGAATGG + Intronic
1024189472 7:46991147-46991169 CTTTTTTTCTTAAAAATCAAAGG - Intergenic
1024382558 7:48714958-48714980 CATTTATTTTTAATGAGGAAAGG - Intergenic
1026371555 7:69704871-69704893 CTTTTTTTCTTTTTGAGGCAGGG + Intronic
1026685993 7:72510626-72510648 TTTTTTTTCTAAATGGGGAATGG + Intergenic
1027703465 7:81498637-81498659 CTTTTTTTTTTTCAGACGAATGG + Intergenic
1028004383 7:85544571-85544593 CTTTTTTTTTTAATCAGAAATGG - Intergenic
1028078506 7:86545238-86545260 CTTTTTTTACTAAAGAGGAATGG + Intergenic
1028299949 7:89185870-89185892 CTTTTTTTCTTATTGAGACAGGG - Intronic
1028801593 7:94971410-94971432 CTTTTTTTCTTTATTACCCATGG + Intronic
1029054162 7:97722953-97722975 ATTTTTTTCTTAATGCCTCATGG - Intergenic
1029832067 7:103271949-103271971 CTTTTTTTCTGAAAAAAGAAAGG + Intergenic
1030122882 7:106127874-106127896 CTTTTTTTTTCAATGGTGAAAGG - Intergenic
1030423558 7:109341126-109341148 TTTTTTTTTTTAATCATGAATGG + Intergenic
1030766737 7:113419637-113419659 TTTTTTTTTTTAATGAAGACTGG + Intergenic
1030999843 7:116402096-116402118 CTTTTTTTCTTATTAAAGAATGG + Intronic
1031063084 7:117073989-117074011 ATTTTTTTCTTAATTTCAAAAGG - Intronic
1031081584 7:117263476-117263498 GTTTTTTTTTTAATGAAGATTGG + Intergenic
1031323920 7:120367642-120367664 TTTTTTTTTTTAATGAAGGAGGG + Intronic
1031504254 7:122561332-122561354 CTTTTTTTTTTAAACAAGAAAGG + Intronic
1032365903 7:131299534-131299556 CTTTTTTTCTAAATGGGAAAAGG - Intronic
1033188932 7:139258170-139258192 CTACTATTCTTAATGACAAATGG - Intronic
1034205729 7:149313152-149313174 GTTTTTTTTTTAATGGGGAAAGG - Intergenic
1034983039 7:155490533-155490555 CCTTTTCTCTTAAAGACGCAGGG - Intronic
1036564423 8:9926205-9926227 CTTTTTTTCTGAATATGGAATGG - Intergenic
1036951734 8:13147093-13147115 ATTTTTTTGTTACTGATGAATGG - Intronic
1037060204 8:14498396-14498418 CTTTTTATCATAATGAAGCATGG + Intronic
1037440858 8:18914185-18914207 TTTTTTTTCTTTATCATGAAAGG - Intronic
1037947717 8:22999640-22999662 CTTTTTTTGTGAATGAAAAAAGG + Intronic
1038009293 8:23461745-23461767 CTTTTTTTCAAAATTATGAATGG - Intergenic
1038195210 8:25360857-25360879 CTTTTTTTCTTACTTAACAATGG - Intronic
1039102984 8:33960263-33960285 TTTTTTTTCTAAATGAGAAACGG + Intergenic
1039165630 8:34676664-34676686 CTTTTTTTCTTAGTTATGAGTGG - Intergenic
1039246991 8:35620035-35620057 CTTTTATTCTGAATGAGGGAAGG - Intronic
1039348719 8:36737213-36737235 GTTTTTTTTTTAATCATGAATGG - Intergenic
1039449749 8:37662860-37662882 ATTTTTTTCTTAAAGAGGGAAGG - Intergenic
1039809815 8:41036733-41036755 TTTTTTTTTTTAATGAAGATGGG + Intergenic
1040847967 8:51864942-51864964 CTTTTTTTCTTAGTTGCTAAAGG - Intronic
1041126926 8:54650969-54650991 ATTTTTTTTTTAATCATGAAAGG + Intergenic
1041350179 8:56940447-56940469 CTTTTTTTCTTAAATAAGATAGG + Intergenic
1042018414 8:64343030-64343052 TTTTTTTTCTTAATAGCGACAGG - Intergenic
1042162438 8:65910814-65910836 CTTTTTTTCTTACTGCAAAATGG + Intergenic
1042493714 8:69432698-69432720 TTTTTTTTCTTAATCATGTAAGG - Intergenic
1042628283 8:70784893-70784915 TTTTTTTTTTTAATCATGAAAGG + Intronic
1043126537 8:76403631-76403653 CATTTTTGTTTAATGAAGAATGG - Intergenic
1043387698 8:79765047-79765069 ATTTTTTTTTTAAAGACTAAAGG - Exonic
1043559373 8:81472610-81472632 TTTTTTTTTTTAATCATGAAAGG + Intergenic
1044375961 8:91470917-91470939 CTTTTTTTTTTAATCAGAAAAGG - Intergenic
1044591886 8:93921076-93921098 TTTTTTTTTTTAATCATGAAGGG + Intronic
1044669767 8:94667424-94667446 TTTTTTTTTTTAATTAAGAAAGG - Intronic
1045137573 8:99237876-99237898 TTTTTTTTTTTAATTAAGAATGG + Intronic
1045509227 8:102800943-102800965 CTTTTTTTTTTAATCATGAAAGG - Intergenic
1046101101 8:109615050-109615072 CTCTTTATCTTAATGACCAAAGG + Intronic
1046289806 8:112142889-112142911 CTAATTTTCTTCATGACTAAAGG + Intergenic
1046710822 8:117509568-117509590 TTTTTCTTCTTGATGACAAATGG - Intergenic
1047086329 8:121520306-121520328 CTTTTTTTTTTAATCATGAATGG - Intergenic
1047706555 8:127505266-127505288 CTCTTTTTCTTTATGACAGAGGG - Intergenic
1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG + Intergenic
1051116621 9:13701525-13701547 TTTTTTTTTTTAATCATGAAAGG + Intergenic
1051211021 9:14743866-14743888 CTTTTTTTCTCCTTGAGGAAAGG - Intronic
1051308134 9:15738285-15738307 CTTTTTTCCTTAATGAATCACGG - Intronic
1051471612 9:17448985-17449007 CTTTCTTTCCTATTGAGGAAAGG + Intronic
1051495806 9:17721605-17721627 CTTTTTTTCTTTAGGTGGAATGG - Intronic
1051683744 9:19635299-19635321 CTTTTTTTCCTAATTACTATTGG + Intronic
1051837331 9:21355484-21355506 GTTTTTTTTTTAATCATGAAAGG - Intergenic
1052482193 9:29045572-29045594 TTTTTTTTTTTAATCATGAAGGG - Intergenic
1052608045 9:30731216-30731238 CTTTTCTTCTCAGTGAAGAAAGG - Intergenic
1053046438 9:34923055-34923077 TTTTTTTTTTTAATCATGAAGGG + Intergenic
1053086172 9:35224982-35225004 GTTTTTTTTTTTATGATGAAGGG - Intronic
1053327268 9:37165671-37165693 CTTTTTTTCTAAATGCAAAAAGG - Intronic
1053464717 9:38297360-38297382 TTTCTTTTCTTCATGACGAGAGG - Intergenic
1053668468 9:40335469-40335491 CTTTTTATCATAATGAAGAATGG - Intergenic
1053918267 9:42961766-42961788 CTTTTTATCATAATGAAGAATGG - Intergenic
1054379608 9:64475521-64475543 CTTTTTATCATAATGAAGAATGG - Intergenic
1054516143 9:66040824-66040846 CTTTTTATCATAATGAAGAATGG + Intergenic
1055399968 9:75912847-75912869 CTCTTTTTGTAAATGACAAAGGG + Intronic
1055768311 9:79689332-79689354 TTTTTTTTCTTAATCAGGCAGGG + Intronic
1056226844 9:84504240-84504262 TGTTTTTTCTTAATGTAGAATGG - Intergenic
1056280843 9:85039889-85039911 CTTTTTTTCTTTTTAACCAAGGG - Intergenic
1057091534 9:92262419-92262441 TTTTTATTCTTAATGACTAGAGG + Intronic
1057623897 9:96660719-96660741 GATTTTTTCCTAATTACGAAGGG - Intergenic
1058757947 9:108100996-108101018 CTTCTTTACTAAATGAGGAAAGG - Intergenic
1058842070 9:108919558-108919580 TTTTTTTTTTTAATGCCGAAAGG - Intronic
1059083582 9:111275699-111275721 TTTTTTTTTTTAATGAAGACAGG - Intergenic
1059227752 9:112688478-112688500 TTTTTTTTTTTAATGACAGAGGG - Intronic
1059625238 9:116057232-116057254 CTTCTTTTTTTAATGCTGAATGG - Intergenic
1060122461 9:121006669-121006691 CTTTTTTTGTAAATGAAGAAGGG - Intronic
1061628220 9:131855000-131855022 CTTGCTTTCTTAATTACAAAAGG - Intergenic
1185667594 X:1779077-1779099 TTTTTTTTTTTAATGACAAGTGG + Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186455813 X:9708995-9709017 GTTTTTTTCTTAATGAAGTATGG + Intronic
1186656864 X:11621708-11621730 GATTTTTTTTTAATGAAGAACGG + Intronic
1186899624 X:14039913-14039935 TTTTTTTTCTTAATGTAGAAGGG - Intergenic
1187736510 X:22310416-22310438 TTTTTTTTTTAAATGATGAATGG + Intergenic
1187968386 X:24635509-24635531 CTTTTTTTCTGAGTCACTAAAGG + Intronic
1188346434 X:29072210-29072232 TTTTTTTCCTTAATGAGTAAAGG - Intronic
1188500241 X:30817955-30817977 TTTTTTTTTTAAATCACGAAAGG - Intergenic
1189102250 X:38203229-38203251 TTTTTTTTTTAAATCACGAATGG - Intronic
1189301195 X:39953787-39953809 CTGTTTCTCTTAATCACCAAGGG - Intergenic
1189858508 X:45248149-45248171 CTTTTTTTCTGCTTGAGGAAAGG - Intergenic
1190089290 X:47423725-47423747 ATTTTTTTCTTAATGAGGTGGGG - Intergenic
1190444694 X:50512342-50512364 TTTTTTTTCCTAAGGATGAAAGG + Intergenic
1190525843 X:51328848-51328870 CTTTTTTTCAGAATTAGGAAGGG - Intergenic
1190543634 X:51502814-51502836 CTTTTTTTCAGAATTAGGAAGGG + Intergenic
1190706016 X:53028803-53028825 CTTTTTTTTTAAATGACAAATGG + Intergenic
1191666767 X:63710627-63710649 ATTTTTTTTTTAATCATGAAAGG - Intronic
1191793360 X:64995100-64995122 TTTTTTTTTTTAATGACAAGGGG - Intronic
1191829943 X:65406446-65406468 TTTTTTTTTTTAATCATGAAGGG - Intronic
1193241365 X:79174086-79174108 ATATTTTTCTTAAAGAGGAAGGG + Intergenic
1193444745 X:81586843-81586865 CTTATTTTCTTAATTATTAATGG + Intergenic
1193546269 X:82833980-82834002 TTTTTTTTTTTAATTATGAAAGG - Intergenic
1194320888 X:92444736-92444758 TTTTTTTTTTTAATGATGAAGGG + Intronic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1195112604 X:101662624-101662646 CTTTTTTTTTAAATTAGGAATGG + Intergenic
1195379543 X:104257276-104257298 TTTTTTTTCTTAATGGAGGAAGG - Intergenic
1196188474 X:112770522-112770544 CTTTTTTTCTTTATGCTCAAAGG - Intergenic
1196503826 X:116417018-116417040 CTTTTTTTCTTAATTTTGGAGGG + Intergenic
1197515818 X:127426961-127426983 TTTTTTTTCTTAATAACTGAGGG + Intergenic
1198244135 X:134813036-134813058 CTTATTTTCTTAATACCAAAGGG + Intronic
1198257128 X:134933618-134933640 CTTTTTTTCTAAACAAGGAAAGG + Intergenic
1199276386 X:145948469-145948491 TTTTTTTTCTGAATGATGGAAGG - Intergenic
1199362395 X:146937555-146937577 TTTTTTTTTTTAATCATGAAAGG + Intergenic
1200629003 Y:5557868-5557890 ATTTTTTTTTTAATGATGAAGGG + Intronic
1201519227 Y:14853837-14853859 CTTTTCTTTTTAATGAGAAATGG + Intergenic