ID: 984135988

View in Genome Browser
Species Human (GRCh38)
Location 4:175939926-175939948
Sequence CAGAAATATTATATGTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984135988_984135990 22 Left 984135988 4:175939926-175939948 CCAGACTACATATAATATTTCTG 0: 1
1: 0
2: 1
3: 18
4: 213
Right 984135990 4:175939971-175939993 AGATCTTAACATGCCAGTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984135988 Original CRISPR CAGAAATATTATATGTAGTC TGG (reversed) Intronic
902596377 1:17512409-17512431 CAAAAAAATTAAATGTAGGCTGG - Intergenic
909264449 1:73538208-73538230 CAATAATATTATATATGGTCTGG + Intergenic
910186993 1:84554459-84554481 CATAAATACTATATGGAGTCAGG + Exonic
910586800 1:88889720-88889742 TAGAAATATTATATTTAGGCTGG + Intronic
910922011 1:92358428-92358450 TAGAGATATTTTATCTAGTCAGG - Intronic
916523453 1:165587101-165587123 CAGAAATTTTATATGGCGCCTGG - Intergenic
917781535 1:178402422-178402444 CATATATATTATATATAGTAAGG + Intronic
919550051 1:198974747-198974769 CAGAAACATTCTATATAATCAGG + Intergenic
921087556 1:211809999-211810021 CTGAACTATTATATATAGTAAGG + Intronic
921822265 1:219630782-219630804 CAGAATGATCATATGTCGTCAGG + Intergenic
1064057773 10:12112151-12112173 CAAAAATATTAAAATTAGTCAGG + Intronic
1064516671 10:16156790-16156812 CTGAAATATTATAAGTAGGCAGG + Intergenic
1065277793 10:24103404-24103426 CAGAAATTTTTGATGTAGGCTGG - Intronic
1066709212 10:38215636-38215658 CAGAAATCTTAAATGTGGTTAGG - Intergenic
1066980158 10:42405586-42405608 CAGAAATCTTAAATGTGGTTAGG + Intergenic
1068259351 10:54558088-54558110 CAGAAATCTGATATGCAATCAGG + Intronic
1068308236 10:55243296-55243318 CATAAATATTAAATGCAGACAGG + Intronic
1069426098 10:68290007-68290029 CAGCAAGATTATGTGCAGTCAGG - Intronic
1070711396 10:78685681-78685703 CAGAAAGATTATTTGTAAGCAGG + Intergenic
1071732563 10:88263265-88263287 CAGAGAAATTATATGGTGTCTGG + Intergenic
1071766436 10:88670958-88670980 CAACTATATAATATGTAGTCTGG - Intronic
1072005908 10:91246921-91246943 CAGAGATGTGATATATAGTCAGG + Intronic
1072097255 10:92194090-92194112 CAGAAATGTTAAAGGTAGGCCGG - Intronic
1072281558 10:93870455-93870477 CAGAAAAACTTTATCTAGTCTGG - Intergenic
1078192462 11:9103028-9103050 CAGAAATATTATACATAAACAGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080241481 11:30132035-30132057 CAGAAATATTGTAAGTGGTTAGG - Intergenic
1081442039 11:43091314-43091336 TAGAAATAGTATCTGTGGTCAGG - Intergenic
1081913038 11:46712607-46712629 AATAAAAATTATATGTGGTCAGG - Intergenic
1082183058 11:49143768-49143790 CCAAAATATTATATGTAATTTGG - Intergenic
1085540079 11:77259274-77259296 CAGAAATATTCAGTGTAGGCTGG - Intronic
1085794998 11:79531202-79531224 CTGAAATATTGTATTCAGTCAGG - Intergenic
1086449692 11:86903777-86903799 TTAAAAGATTATATGTAGTCCGG - Intronic
1088931388 11:114354357-114354379 CATAAATATTTGATGTATTCTGG + Intergenic
1088981697 11:114870423-114870445 CAGAGATAGGAAATGTAGTCAGG + Intergenic
1089204344 11:116747022-116747044 CTGAAATATTCCATGTAGCCGGG + Intergenic
1093360489 12:18220464-18220486 GAGAAATATTTTATTTAGCCCGG - Intronic
1093851291 12:24042148-24042170 TAAAAATGTTATATGTATTCAGG - Intergenic
1094079810 12:26521482-26521504 CAGATTCATTATATGCAGTCAGG + Intronic
1094138076 12:27150736-27150758 AATAAAAATTATATGTATTCAGG - Intergenic
1094247285 12:28313324-28313346 TAAAAATAGTATGTGTAGTCTGG + Intronic
1095528662 12:43158406-43158428 CAGAAATCTTCTAGGTTGTCTGG + Intergenic
1095603388 12:44038996-44039018 CAGTAAAATTATATGATGTCTGG - Intronic
1095843515 12:46720747-46720769 CAGATATACTTTGTGTAGTCAGG - Intergenic
1098468064 12:70811363-70811385 CAGACATGATATTTGTAGTCTGG + Intronic
1099354247 12:81613478-81613500 AAGAAATATTTTATTGAGTCAGG - Intronic
1100430838 12:94530618-94530640 AAGTCATATTATATGTACTCCGG + Intergenic
1101776905 12:107803906-107803928 CAAAAATAATATATGTATTAAGG + Intergenic
1102102879 12:110294361-110294383 CAAAAAAATTATATTTGGTCAGG + Intronic
1106251307 13:27983644-27983666 CAGAAAAAATATATGTAATATGG - Intronic
1106989276 13:35397375-35397397 TAGAAATATTATATACAGTATGG - Intronic
1107010839 13:35669354-35669376 GAGGAATATTACATGTAGTTGGG - Intronic
1107755448 13:43616496-43616518 TAAAAATATTATATGTCGGCTGG - Intronic
1107922582 13:45225174-45225196 GAGAAATATATTCTGTAGTCTGG + Intronic
1108100548 13:46949402-46949424 CAGAAATATGAGTCGTAGTCTGG + Intergenic
1109823948 13:67692708-67692730 CAGAAATTTTATAAGTAGCAAGG - Intergenic
1110853106 13:80267385-80267407 CATAGACATTATATGTAGTAGGG - Intergenic
1111023349 13:82485068-82485090 CAGAAGCATTGTATGTTGTCTGG - Intergenic
1111447064 13:88360630-88360652 CAGATATATTTTATATATTCTGG - Intergenic
1115097399 14:29653610-29653632 CAAAAATATTATCTTTAATCTGG + Intronic
1116187339 14:41613769-41613791 CAGAAATAGCATATGTAATCAGG + Intronic
1116242465 14:42362870-42362892 AAGAAAAATTAAAAGTAGTCAGG - Intergenic
1116647812 14:47552041-47552063 TTGAAATATTATTTTTAGTCTGG - Intronic
1116925848 14:50636001-50636023 TAGAAGAATTATATGTAGGCCGG - Intronic
1117750077 14:58912153-58912175 CAAAAATAATATGTGTATTCTGG + Intergenic
1117907108 14:60601724-60601746 AAAAAATATTTTATGTAGGCCGG + Intergenic
1117941362 14:60969629-60969651 CAGGAATAGGATATGCAGTCTGG - Exonic
1118874768 14:69774370-69774392 CAGATAGATTATTTGGAGTCAGG - Intergenic
1120121691 14:80687909-80687931 CAAAAATAAAATATATAGTCTGG + Intronic
1120333397 14:83122815-83122837 CAGAATTAATATATTCAGTCAGG + Intergenic
1120440767 14:84535942-84535964 CAGAACTATTATTTTTAGTGGGG + Intergenic
1123687726 15:22811310-22811332 CAGAAATATTATGTTTGGCCAGG + Intronic
1123949333 15:25255592-25255614 CAGCAATATTATAAGTCATCCGG + Intergenic
1126022199 15:44412704-44412726 TAGAAATAATATATTTAGGCTGG + Intronic
1127369031 15:58319200-58319222 CAGCAATATTTTATGTCTTCTGG - Intronic
1127832460 15:62762967-62762989 CAGAAATGTTATATCTACTTGGG - Intronic
1128030757 15:64477923-64477945 CAGAAATAAGATATGCAGCCAGG - Intronic
1131915523 15:97261351-97261373 CTAAAATAATCTATGTAGTCTGG - Intergenic
1132098005 15:99002290-99002312 TACAAATATTTTATGTAGGCTGG - Intronic
1134816488 16:17210201-17210223 TAGAAAAATTATCTGTAGGCTGG + Intronic
1134863271 16:17580216-17580238 AAGACAAATTATATGTAGGCAGG + Intergenic
1135159213 16:20078703-20078725 AAGGAAAATTCTATGTAGTCTGG + Intergenic
1135433002 16:22402804-22402826 CAAAAATATCACATGTAGGCAGG + Intronic
1135638477 16:24099674-24099696 AAGAAATATTTTATGTTGGCTGG + Intronic
1137942747 16:52704693-52704715 AAAGAATATTATATGTAGTCTGG - Intergenic
1138873344 16:60919797-60919819 CAGAAATATTCTATAGAGTGAGG + Intergenic
1142052962 16:87971963-87971985 AAAAAATATTTTATGGAGTCGGG + Intronic
1144354495 17:14430964-14430986 CATAAATATTAAATGTACACAGG - Intergenic
1145043368 17:19593300-19593322 TAGAAATGTTTTATGTATTCTGG + Intergenic
1146121662 17:30201129-30201151 GAGAAAAAGTTTATGTAGTCAGG - Intronic
1149290964 17:55217025-55217047 CAGAAATATTAAATAAAGTTTGG - Intergenic
1153416122 18:4847847-4847869 CATTAATAACATATGTAGTCTGG + Intergenic
1155069690 18:22303713-22303735 CCGAGATATTATATGTTGCCAGG - Intergenic
1155417487 18:25614709-25614731 CAGAAATTTCAAATGTAGTCAGG - Intergenic
1158290204 18:55932305-55932327 CAGAAAAATTCTAGGTAGACAGG + Intergenic
1161694247 19:5757020-5757042 CAGGCATATCATATGAAGTCAGG + Intronic
1164089724 19:21938070-21938092 AAGAAATTTTCTGTGTAGTCGGG - Intronic
1167972714 19:53198363-53198385 CAGAAGTGTTATATGTTGGCTGG - Intergenic
926573596 2:14556353-14556375 CAGAAATAAGATATGGAGTGGGG + Intergenic
928426747 2:31185018-31185040 CAAAAAGATGAAATGTAGTCAGG - Intronic
928740709 2:34348812-34348834 CAGAAATAGTTTATGATGTCAGG - Intergenic
928855279 2:35796036-35796058 AAGAAATCTTATATGTAATTTGG + Intergenic
928976210 2:37089232-37089254 CCGAAATATTAACTGTTGTCAGG + Intronic
929310101 2:40413663-40413685 CAGTGATATTATATGTAGTAAGG - Intronic
929725190 2:44418029-44418051 CAAAAATATAAAAAGTAGTCGGG + Intronic
930149688 2:48045837-48045859 CAGAAATAACTTCTGTAGTCTGG - Intergenic
932129286 2:69173287-69173309 TAGAAATATCAGATGGAGTCAGG - Intronic
935038722 2:99404870-99404892 CTGAAGTACTATGTGTAGTCTGG + Intronic
936670653 2:114652262-114652284 TAGAAATTATATATTTAGTCTGG - Intronic
938550622 2:132378226-132378248 AAGAAAGATCATATGTAGTATGG + Intergenic
941072948 2:160975315-160975337 AAGAAATGTTATATCTAGGCTGG - Intergenic
941871429 2:170389841-170389863 CTTAAATATTATATATATTCTGG - Intronic
942542521 2:177029460-177029482 CAGAAATATCAGATGTGGACAGG - Intergenic
943174539 2:184453492-184453514 TATAAATGTTATATATAGTCAGG + Intergenic
943871164 2:193001732-193001754 CAAAAAAGTTATCTGTAGTCAGG - Intergenic
943993231 2:194725093-194725115 CAGAATTAATATATGTTGTGTGG - Intergenic
945493045 2:210478035-210478057 CAAGAATATTATTTGTAGTATGG - Intronic
945766529 2:213986635-213986657 CAGAAATAACATATGCTGTCTGG + Intronic
946485222 2:220094815-220094837 CAAAAATATTAAATATAGGCAGG - Intergenic
1170074870 20:12408714-12408736 TAGAAATATTATCTGTGGACAGG - Intergenic
1170348688 20:15416562-15416584 CATAAATATGATATGGAGTCAGG + Intronic
1170936385 20:20813602-20813624 CAGAAAAATTATATGCTGGCTGG - Intergenic
1177037844 21:16066580-16066602 AAGAAATATTATCTGTAGCCAGG - Intergenic
1177168606 21:17630527-17630549 CAGAAATATTTTAGACAGTCAGG - Intergenic
1177745283 21:25205227-25205249 CAGAAATATCAAATGTGGTTTGG + Intergenic
1177815757 21:25974784-25974806 CAGGAATATTAAATCAAGTCAGG + Intronic
1181295661 22:21836547-21836569 CAAAAAAATTATCTGTAGCCGGG + Intronic
1181596218 22:23916637-23916659 AAGAAATATTATATGGGGCCGGG + Intergenic
951222728 3:20085805-20085827 TAGAAAAATTACATGTAGGCAGG - Intronic
951375152 3:21905590-21905612 CAGAAATATTATATAAAATTTGG + Intronic
951501481 3:23392374-23392396 AAGAGATAGTATTTGTAGTCTGG + Intronic
956597099 3:70979432-70979454 CAGAAATATTATTTTACGTCTGG + Intronic
957921167 3:86750020-86750042 CAGAATTATAATTTGTAGTCAGG - Intergenic
959591024 3:108081580-108081602 CAGAAATAGTATTTTTACTCAGG - Intronic
960391966 3:117088554-117088576 CAGAAATATTTAATGAATTCTGG - Intronic
960466333 3:118000269-118000291 CAGAAATCCTATATGTTGCCTGG + Intergenic
964529974 3:157657059-157657081 CAGAGCAATTATTTGTAGTCTGG - Intronic
965909949 3:173761675-173761697 CAGAAATATTTCTTCTAGTCTGG + Intronic
966486487 3:180476647-180476669 AAGAAATCTTACATGTAATCTGG - Intergenic
970686709 4:18576475-18576497 CAGAAATAATATATTTAATGAGG - Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
971403096 4:26294581-26294603 CAAAATTTTTATATGTAGGCTGG + Intronic
972336881 4:38114909-38114931 CAGGCATAATATGTGTAGTCTGG + Intronic
972366485 4:38380248-38380270 CAGAATTATCATATGTGGTGAGG + Intergenic
974853069 4:67427096-67427118 CAAAAGTATTTTATGTTGTCAGG + Intergenic
977113008 4:92984402-92984424 CAGAAAAATTGTATGTAGACAGG - Intronic
977454473 4:97240573-97240595 CAAAAATATTTTATTTTGTCAGG - Intronic
979094363 4:116527558-116527580 CAGAAGTGTAATATGTAGGCAGG + Intergenic
980559625 4:134456021-134456043 CAGTCATATTTTATGTAGTATGG + Intergenic
981077826 4:140608317-140608339 CAGAAATAGAATGTGTAGGCTGG + Intergenic
982636728 4:157906095-157906117 CAGAAATGTTATGTGTAGGGAGG + Intergenic
983524957 4:168751306-168751328 CAAAAATATAATATGTGGACTGG - Intronic
983727715 4:170949617-170949639 ATGTAATATTATATGTAGTTTGG + Intergenic
984135988 4:175939926-175939948 CAGAAATATTATATGTAGTCTGG - Intronic
984899599 4:184573423-184573445 TAGGAAAATTATATTTAGTCTGG + Intergenic
984969271 4:185172033-185172055 CTGAAATATTATTTTTAGCCAGG - Intronic
986586508 5:9323820-9323842 CAGAAATATAAAAATTAGTCAGG - Intronic
987562034 5:19536916-19536938 CAAAAATATAATGTGTAGTCAGG + Intronic
987841185 5:23224553-23224575 CAGATTTATTATATGTAATTTGG - Intergenic
989049744 5:37307549-37307571 CAGAAATATTTTATGTTAGCAGG - Intronic
990576616 5:57129459-57129481 ATGAAATATTACATGTAGGCCGG + Intergenic
991193547 5:63904743-63904765 CAGAAATAATATATGTTGCTTGG - Intergenic
992736603 5:79727967-79727989 AATAAATGTTATCTGTAGTCAGG - Intronic
993110264 5:83648454-83648476 CAGAATAAATATATGTAGTTTGG + Intronic
993392275 5:87334459-87334481 CAGAAATATAATGTTTAATCTGG + Intronic
996643727 5:125790658-125790680 TAAAAATATCATATGTATTCTGG + Intergenic
999288066 5:150406099-150406121 CTTAAATGTTATATGTAGTCTGG - Intronic
1002359698 5:178660929-178660951 CAGAAATAGCATCTGGAGTCTGG - Intergenic
1003809457 6:9763776-9763798 CAAAGATATTATATGATGTCGGG - Intronic
1004055882 6:12138664-12138686 CAGAAATGGTATCTGAAGTCAGG - Intronic
1004718387 6:18241723-18241745 AACAAAGATTATATGTAGCCGGG - Intronic
1007443272 6:41883012-41883034 AAGAAATATTATATATATTAAGG + Intronic
1007874423 6:45079535-45079557 CAGTAATATTATTTGAAGTGAGG - Intronic
1008353862 6:50527667-50527689 CAGAAATTTGATATTTGGTCAGG + Intergenic
1009060301 6:58390057-58390079 GAGAAATAATATATGTATTTAGG - Intergenic
1009230610 6:61057342-61057364 GAGAAATAATATATGTATTTAGG + Intergenic
1009710794 6:67316196-67316218 CAAAAATATATTATGTAGTCAGG + Intergenic
1011843629 6:91533368-91533390 CAGAAAAAATATCTGTAGTCAGG - Intergenic
1012081624 6:94765441-94765463 CAGAAATATAATTTATATTCAGG - Intergenic
1013175926 6:107676405-107676427 GAAAAATATTAGATGAAGTCAGG + Intergenic
1014853671 6:126372494-126372516 CAGAAGTGTTATAAGTATTCTGG - Intergenic
1015215283 6:130743012-130743034 AAGAAATAATATATTTAATCAGG + Intergenic
1016452687 6:144199479-144199501 CATATATATGATATGTAATCTGG + Intergenic
1016539311 6:145145633-145145655 CAGAATTTTTATATGTATTAGGG + Intergenic
1018656784 6:166044651-166044673 CATAAACATTTTATATAGTCAGG + Intergenic
1021419006 7:20423840-20423862 CATACATATTATATCTATTCTGG + Intergenic
1022511833 7:30940245-30940267 TAGGAATATTGTATATAGTCTGG + Intronic
1022831473 7:34071760-34071782 CAGAAACATTTAATGTAGTTGGG + Intronic
1023548009 7:41339318-41339340 CAGAGAGATTATCTGTAGGCTGG - Intergenic
1024418368 7:49134601-49134623 AAGAAAGAATATATGTAGACAGG + Intergenic
1027837617 7:83265084-83265106 CAGAAATGTAATATATAATCAGG - Intergenic
1028864535 7:95692483-95692505 CAGCAATATTATAATTACTCAGG + Intergenic
1030418603 7:109277951-109277973 CAGAACTATTATCTGAATTCTGG + Intergenic
1030522701 7:110618043-110618065 CAGAAATAGTATATTTTGTATGG - Intergenic
1039360874 8:36875470-36875492 CAGATATATTATATATATACTGG + Intronic
1040400868 8:47048078-47048100 TAAAAATATTATGTGTAGGCTGG - Intergenic
1041118318 8:54562389-54562411 AAGAAATATTTTAAGTAGGCTGG + Intergenic
1041602974 8:59743801-59743823 CAGTTATATTAAATTTAGTCAGG - Intergenic
1041695359 8:60730562-60730584 TAGAAATATTAAATGGAGGCCGG + Intronic
1044139643 8:88634849-88634871 TAGAAATAGTCTATGTAGCCAGG + Intergenic
1044197694 8:89397205-89397227 TAGAAAAATTATAAGTAGTTGGG - Intergenic
1045040300 8:98217361-98217383 GAGAAATATAAAATGTATTCAGG + Intronic
1045188327 8:99859768-99859790 CAGAAATATTAAAGGTGTTCAGG + Intronic
1046035718 8:108838755-108838777 CAGAAATACTCTATATAGCCTGG - Intergenic
1046275032 8:111947785-111947807 CAGAAATACTATTTGTGCTCAGG + Intergenic
1046689803 8:117269616-117269638 TAGAATTATAATATGTAGGCTGG - Intergenic
1047752899 8:127895571-127895593 CAGGCATATAATATGTACTCAGG + Intergenic
1047800850 8:128307978-128308000 AGGAAATATAATATATAGTCTGG - Intergenic
1048120572 8:131576489-131576511 AAGAAAAAGTATATGTATTCAGG + Intergenic
1050891631 9:10831488-10831510 CAGGAATAATATAAGTAGGCTGG + Intergenic
1052187554 9:25618037-25618059 CAAAAAGATTATATTCAGTCTGG + Intergenic
1054821173 9:69521797-69521819 CAGAAATAATGTTTGTAGGCAGG + Intronic
1055483754 9:76736205-76736227 CAGAAATAGTATAAGCACTCTGG + Intronic
1056566209 9:87774821-87774843 TAGAAATATTGCATGTAGGCCGG - Intergenic
1058256728 9:102776001-102776023 CTGAAGTATTATTTGAAGTCAGG + Intergenic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059896643 9:118873541-118873563 CAGGATTCTTATATGTATTCTGG - Intergenic
1187323233 X:18260771-18260793 CAGAATTATTGTATGTAATATGG - Intronic
1188157740 X:26761239-26761261 CAAAAAAATTATATATAATCAGG + Intergenic
1188655827 X:32694057-32694079 CAGCAATATTTAATGTAGTTAGG + Intronic
1188709788 X:33381135-33381157 TAGACATATTTTTTGTAGTCTGG - Intergenic
1190984177 X:55486456-55486478 CAGAAATATCTTGTGAAGTCAGG - Exonic
1191118594 X:56877993-56878015 CTGCAATATTATTTGAAGTCAGG + Intergenic
1193124755 X:77859378-77859400 CAGCAATATTATATGTTTTCTGG - Intronic
1193988090 X:88271465-88271487 GAGAAATAATATATGTATTCAGG + Intergenic
1194381955 X:93203689-93203711 AAAACAAATTATATGTAGTCAGG + Intergenic
1194665827 X:96676521-96676543 CACAAATACCATATTTAGTCAGG - Intergenic
1197163577 X:123350918-123350940 CAGATATATTAAATGTAATAAGG - Intronic
1197333979 X:125188935-125188957 CAGAAATATTTTTTGTAGTCTGG - Intergenic
1197531900 X:127639078-127639100 AAGAATTATTATATTTAGGCAGG - Intergenic
1198439670 X:136650963-136650985 AAGTGATATTATATGGAGTCTGG - Intronic
1199741199 X:150738155-150738177 CAGAAATATTAGTGGTTGTCAGG - Intronic
1201332724 Y:12844487-12844509 CAGGAATCTCATATGTAGTCAGG - Intronic