ID: 984140869

View in Genome Browser
Species Human (GRCh38)
Location 4:176002323-176002345
Sequence TCTGGGGACTGCAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 434}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984140869_984140875 6 Left 984140869 4:176002323-176002345 CCTGCTTCTCTGCAGTCCCCAGA 0: 1
1: 0
2: 1
3: 62
4: 434
Right 984140875 4:176002352-176002374 CGAGTGACCAGACGCTGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
984140869_984140876 7 Left 984140869 4:176002323-176002345 CCTGCTTCTCTGCAGTCCCCAGA 0: 1
1: 0
2: 1
3: 62
4: 434
Right 984140876 4:176002353-176002375 GAGTGACCAGACGCTGCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 56
984140869_984140874 5 Left 984140869 4:176002323-176002345 CCTGCTTCTCTGCAGTCCCCAGA 0: 1
1: 0
2: 1
3: 62
4: 434
Right 984140874 4:176002351-176002373 GCGAGTGACCAGACGCTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984140869 Original CRISPR TCTGGGGACTGCAGAGAAGC AGG (reversed) Exonic