ID: 984140871

View in Genome Browser
Species Human (GRCh38)
Location 4:176002339-176002361
Sequence TGGTCACTCGCTCTCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984140871_984140875 -10 Left 984140871 4:176002339-176002361 CCCCAGAGGAGAGCGAGTGACCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 984140875 4:176002352-176002374 CGAGTGACCAGACGCTGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
984140871_984140879 16 Left 984140871 4:176002339-176002361 CCCCAGAGGAGAGCGAGTGACCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 984140879 4:176002378-176002400 AAGTTCTCCAAGCCGCGCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 50
984140871_984140876 -9 Left 984140871 4:176002339-176002361 CCCCAGAGGAGAGCGAGTGACCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 984140876 4:176002353-176002375 GAGTGACCAGACGCTGCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984140871 Original CRISPR TGGTCACTCGCTCTCCTCTG GGG (reversed) Intronic