ID: 984140871 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:176002339-176002361 |
Sequence | TGGTCACTCGCTCTCCTCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 142 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 131} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
984140871_984140875 | -10 | Left | 984140871 | 4:176002339-176002361 | CCCCAGAGGAGAGCGAGTGACCA | 0: 1 1: 0 2: 0 3: 10 4: 131 |
||
Right | 984140875 | 4:176002352-176002374 | CGAGTGACCAGACGCTGCGCGGG | 0: 1 1: 0 2: 0 3: 2 4: 33 |
||||
984140871_984140879 | 16 | Left | 984140871 | 4:176002339-176002361 | CCCCAGAGGAGAGCGAGTGACCA | 0: 1 1: 0 2: 0 3: 10 4: 131 |
||
Right | 984140879 | 4:176002378-176002400 | AAGTTCTCCAAGCCGCGCTGAGG | 0: 1 1: 0 2: 0 3: 6 4: 50 |
||||
984140871_984140876 | -9 | Left | 984140871 | 4:176002339-176002361 | CCCCAGAGGAGAGCGAGTGACCA | 0: 1 1: 0 2: 0 3: 10 4: 131 |
||
Right | 984140876 | 4:176002353-176002375 | GAGTGACCAGACGCTGCGCGGGG | 0: 1 1: 0 2: 0 3: 6 4: 56 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
984140871 | Original CRISPR | TGGTCACTCGCTCTCCTCTG GGG (reversed) | Intronic | ||