ID: 984140872

View in Genome Browser
Species Human (GRCh38)
Location 4:176002340-176002362
Sequence CTGGTCACTCGCTCTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984140872_984140882 30 Left 984140872 4:176002340-176002362 CCCAGAGGAGAGCGAGTGACCAG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 984140882 4:176002393-176002415 CGCTGAGGCTCCTCGCGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
984140872_984140879 15 Left 984140872 4:176002340-176002362 CCCAGAGGAGAGCGAGTGACCAG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 984140879 4:176002378-176002400 AAGTTCTCCAAGCCGCGCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 50
984140872_984140876 -10 Left 984140872 4:176002340-176002362 CCCAGAGGAGAGCGAGTGACCAG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 984140876 4:176002353-176002375 GAGTGACCAGACGCTGCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984140872 Original CRISPR CTGGTCACTCGCTCTCCTCT GGG (reversed) Intronic
900188281 1:1342973-1342995 CTGCTAACGCACTCTCCTCTCGG + Intronic
903540231 1:24092604-24092626 CAGGTCACTCACTCACCTCCAGG - Intronic
903806495 1:26009391-26009413 CTGGCCCCTCCCTCTCCTCCAGG - Intergenic
904440392 1:30525975-30525997 CTGTCCACTCACTCCCCTCTCGG - Intergenic
904821531 1:33247921-33247943 CTGGGCACTCTCCCTTCTCTGGG + Intergenic
905371920 1:37486928-37486950 CTGCTCACTCACTCTTGTCTTGG - Intergenic
906148780 1:43575683-43575705 CAGGTCACTGGCTCTGCTCTGGG - Intronic
909073548 1:71025744-71025766 CTGGTGACTTTCTCTCCTCTTGG - Intronic
911217144 1:95207354-95207376 CTGGCCAGTCCCTCTCCTCAAGG + Intronic
912154369 1:106899102-106899124 GTGCTCACTCACTCTCCTTTTGG + Intergenic
917515784 1:175706787-175706809 GTGGTGACTATCTCTCCTCTTGG - Intronic
919933251 1:202235295-202235317 CTGCTCACTAGCTGTCCTCTGGG - Intronic
920174756 1:204093583-204093605 CTTGTCACTGGCTGTCCCCTTGG + Intronic
920284619 1:204870662-204870684 TTGCTCACTCGCTCACCGCTGGG - Intronic
921508569 1:216004355-216004377 CTGGTCACTCTCTGTCTCCTTGG - Intronic
923296657 1:232601066-232601088 CTGGTCCCTTGCTCTCCTCTAGG - Intergenic
924266962 1:242292037-242292059 CTTGTAACTCTCTCTCCCCTTGG - Intronic
924830520 1:247589156-247589178 CTGGTCCCTGGATCTACTCTTGG - Exonic
924940856 1:248811818-248811840 CTTCTCACGCCCTCTCCTCTGGG - Exonic
1062881815 10:985169-985191 CAGGTCACTTGCTTTCTTCTCGG - Intergenic
1063344570 10:5299108-5299130 GGGCTGACTCGCTCTCCTCTGGG + Intergenic
1066717855 10:38306459-38306481 CTTGTAACTCTCTCTCCCCTTGG + Intergenic
1067461947 10:46464862-46464884 CTGGTCAGCCCCTCTGCTCTGGG - Intronic
1067625248 10:47919736-47919758 CTGGTCAGCCCCTCTGCTCTGGG + Intergenic
1067749348 10:48959888-48959910 CTGGTCACTGGCCCTCCACTTGG - Intronic
1068283399 10:54906660-54906682 TTGGGCACTCTCTCTCCTCCAGG - Intronic
1069959699 10:72072548-72072570 CTTGTCCCTCTCTGTCCTCTAGG - Exonic
1074447239 10:113530584-113530606 CGGGTCACTCACACTGCTCTGGG - Intergenic
1076264524 10:129099300-129099322 CTGTACACTAGCCCTCCTCTGGG - Intergenic
1076891563 10:133287202-133287224 CTGCTCAGTCCCTTTCCTCTTGG - Intronic
1077108726 11:852951-852973 CTGGTCACTGGCTGCCCACTGGG - Intronic
1083764662 11:64836105-64836127 CTGGTCACTCACCTCCCTCTGGG + Exonic
1084178180 11:67434124-67434146 CCGGTCACTCCCTCTGCCCTGGG - Intronic
1084634852 11:70384966-70384988 CTGGTGTCTGGCTTTCCTCTTGG - Intergenic
1084657790 11:70529075-70529097 CTGGTCACTTACTCCCCTTTGGG + Intronic
1089637240 11:119822958-119822980 CTGGAAACACTCTCTCCTCTGGG - Intergenic
1090355571 11:126138311-126138333 CTCGTCATTCTCTCTCCTCCTGG + Intergenic
1092150420 12:6244487-6244509 CTGGTGCTTCACTCTCCTCTTGG - Intergenic
1096786072 12:54018062-54018084 GTGGGCAGACGCTCTCCTCTCGG - Intronic
1097269956 12:57767814-57767836 CAGCTGACTCGGTCTCCTCTGGG + Intronic
1102559726 12:113753703-113753725 CTGGCCACCCTCTCTCCTGTTGG + Intergenic
1102571523 12:113829846-113829868 CTGGGCACTGCCTGTCCTCTGGG - Intronic
1104019924 12:124985262-124985284 CTGGTCACTTTCCCACCTCTGGG - Intronic
1104035116 12:125092517-125092539 CTGGCCAGTCTCACTCCTCTGGG - Intronic
1108575177 13:51784283-51784305 CTGGTCAGATGCTCCCCTCTGGG - Intronic
1113260112 13:108552433-108552455 CAGCTCACTCACTCTCTTCTCGG + Intergenic
1113904579 13:113813260-113813282 CCAGTCACTCCCTCTCCCCTCGG + Exonic
1114744316 14:25131467-25131489 CTGATCACTCTCTCTTCTCTTGG - Intergenic
1119123325 14:72099998-72100020 CTGGTGACCCGCTCTCTGCTTGG - Intronic
1120524262 14:85559514-85559536 CAGCTCACTCTCTTTCCTCTGGG - Intronic
1120892169 14:89500811-89500833 CTGGTCAAGTTCTCTCCTCTGGG - Intronic
1125755101 15:42058133-42058155 CTGGTCACACCCTCTCTCCTAGG + Intergenic
1128229368 15:66024100-66024122 CTGGTTCCTCACTCTGCTCTGGG - Intronic
1130148871 15:81296191-81296213 CTGGTCTCTCTGTTTCCTCTGGG + Intronic
1133058324 16:3158545-3158567 CTGGTCACCGGCCCTCCTCTCGG + Intergenic
1133127089 16:3654196-3654218 CTGGTCACTCGGGATCCCCTGGG + Intronic
1133245760 16:4447724-4447746 CTAGTCACAGGCTCTGCTCTGGG + Intronic
1133261464 16:4553550-4553572 CTGGTCTCACGCTCTACTCCTGG + Intergenic
1133312984 16:4862931-4862953 CTGGTCACCAGCTCCCCACTGGG - Intronic
1138391769 16:56675706-56675728 CTGCTCACTCGCTCTGCTCCCGG + Intronic
1138544525 16:57707759-57707781 CTGGTGTCTCGCTCTCCCCAAGG - Intronic
1139844545 16:69910820-69910842 CTGGGGACTTGCTCTCCTCTAGG + Intronic
1141458543 16:84161716-84161738 CTGGGCACTTGCTGTCATCTAGG + Intronic
1144784773 17:17825418-17825440 CAGGTCACACCCCCTCCTCTTGG - Intronic
1144907028 17:18644653-18644675 CTTGTCACTCTCTCCCCCCTCGG + Intronic
1146372620 17:32275046-32275068 CTGTTGGCTCTCTCTCCTCTGGG + Intronic
1146720850 17:35122428-35122450 CTGCCCACACGCTCTTCTCTGGG - Intronic
1150601204 17:66652584-66652606 CTGCACACACGCTCTCTTCTTGG - Intronic
1151451143 17:74199044-74199066 CTGGTTACTCACTCTCCCCCTGG - Intergenic
1151468241 17:74301553-74301575 CTGGTCACCTGCCTTCCTCTGGG + Intronic
1152234714 17:79132700-79132722 CTGCTCACTGGCCCTCCCCTGGG + Intronic
1152420164 17:80188450-80188472 CTGGTCGCTGGCTGTCCTCAGGG - Exonic
1152821288 17:82439148-82439170 CTGATCTCTCGCCCTCCTCATGG + Intronic
1155234907 18:23809624-23809646 CTGGCCATTCATTCTCCTCTTGG - Intronic
1157288341 18:46392697-46392719 CTTGTCAGTCTCTCCCCTCTGGG + Intronic
1157499438 18:48179537-48179559 CTGGTCACTCACATTCCTCCCGG - Intronic
1160410719 18:78673772-78673794 ATGGGCACTGGCACTCCTCTTGG + Intergenic
1161310280 19:3590060-3590082 CTGGGCGCTCGCTGTCTTCTTGG - Exonic
1161453190 19:4357879-4357901 CAGGGCCCTGGCTCTCCTCTGGG + Intronic
1161469512 19:4449249-4449271 CTGTTCACCCGCCCTCGTCTGGG - Intronic
1162042224 19:7977876-7977898 CTGGCCACTGGGTCTCCTCTAGG + Intronic
1163698194 19:18774547-18774569 CTGGTGACAGGTTCTCCTCTGGG + Intronic
1164913307 19:32029508-32029530 CTGGTCAGCCTCTCTCCACTTGG + Intergenic
925044688 2:763907-763929 CGGGTCACTCACTCACCTGTAGG + Intergenic
926216465 2:10908628-10908650 TTGGGCACTTGCTCTCCTGTGGG + Intergenic
928170713 2:29001282-29001304 CTGCACACTCGCTCCCCTCCTGG - Intronic
930743514 2:54857832-54857854 CCGCTCACTCACTCTGCTCTGGG - Intronic
937287637 2:120763171-120763193 CTTGTGCCTCCCTCTCCTCTGGG + Intronic
937988276 2:127648416-127648438 CTGGCCACTCGCTCTCCTGAAGG + Intronic
942625720 2:177898057-177898079 CTGGTGATTCGATGTCCTCTAGG + Exonic
943532249 2:189097287-189097309 TTTGGCCCTCGCTCTCCTCTTGG + Exonic
946153740 2:217793698-217793720 GTGGTCTCTTGCTCTCCTCAAGG + Intergenic
948518986 2:238523796-238523818 CAGGTCTCCCTCTCTCCTCTCGG + Intergenic
1170648888 20:18221150-18221172 CTGGTAAATTGCTCTGCTCTGGG + Intergenic
1171240556 20:23564130-23564152 CTGGGAAATCCCTCTCCTCTGGG + Intergenic
1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG + Intronic
1176135059 20:63518962-63518984 CAGGTCACCCGCTTCCCTCTAGG - Intergenic
1181283627 22:21736518-21736540 CTGGCCCCTCGCTCTGCTCCAGG + Intergenic
1181466872 22:23115132-23115154 CTGTCCACTCACTCTCCACTAGG - Intronic
1182035319 22:27193805-27193827 CTGGTCACCCCCTGTCCTGTGGG - Intergenic
1183583795 22:38740523-38740545 CTGGGCACCCGCTCTCCTGACGG - Intronic
1184213629 22:43051884-43051906 CTGGTCACTCTCTCTCCAGCCGG - Exonic
1184597512 22:45523192-45523214 CTGTACACACCCTCTCCTCTGGG - Intronic
1184831622 22:46992417-46992439 CTGGGCACCTGCTCTCCTCCTGG - Intronic
960706228 3:120484286-120484308 CTGATCACTCCCTCAGCTCTTGG + Intergenic
962025276 3:131541091-131541113 CTGGGCATATGCTCTCCTCTTGG + Intronic
965544816 3:169904262-169904284 CTGTCCTCTCGCTCTCCTCCCGG - Intergenic
968538271 4:1148807-1148829 CTGCTCCCTCGGCCTCCTCTGGG + Intergenic
968802974 4:2755629-2755651 CTGGTCCCCCTCTCTCCCCTAGG + Intronic
970191425 4:13522821-13522843 CTGGCAGCTCCCTCTCCTCTGGG + Intergenic
974081455 4:57217531-57217553 CTGATTACTGGATCTCCTCTGGG + Intergenic
978404798 4:108367977-108367999 CTCATCTCTGGCTCTCCTCTGGG + Intergenic
978589413 4:110308838-110308860 CAGGTAACTTGCTCTCCTCTGGG - Intergenic
979050150 4:115920678-115920700 CTGTCCTCTCGCTCTCCTCCCGG + Intergenic
984140872 4:176002340-176002362 CTGGTCACTCGCTCTCCTCTGGG - Intronic
995122084 5:108547040-108547062 CTGGCCACTTGCCCTCATCTTGG + Intergenic
998106381 5:139471741-139471763 CTGGGCACCCCCTCTCCTCCAGG + Intergenic
999400941 5:151263794-151263816 TTGGGCAGTCACTCTCCTCTGGG - Intronic
999753358 5:154646787-154646809 TTGGTCAAGGGCTCTCCTCTGGG + Intergenic
1000116102 5:158154790-158154812 CTAGTCACACACTCTCCTCTAGG + Intergenic
1001808451 5:174608978-174609000 CTTCTCACCCGCTCCCCTCTTGG - Intergenic
1002350192 5:178577645-178577667 CTTGACACTCGCTCTGGTCTGGG - Intronic
1004550292 6:16640342-16640364 CTGTTCTCTCTCCCTCCTCTCGG + Intronic
1006334169 6:33411726-33411748 CTAGTGACTGGCTCTCCTCTCGG - Intronic
1011228853 6:85137493-85137515 CGGGTCACTCACTCTTCCCTAGG + Intergenic
1014517698 6:122399875-122399897 CTCCTCACTCGCTCTCCTGCGGG + Intronic
1016520350 6:144939814-144939836 CTGGTCAATCAATATCCTCTGGG - Intergenic
1024968869 7:55050739-55050761 CTGTTCACGCTCTCTCATCTTGG + Intronic
1025034851 7:55587675-55587697 CTGGTGACTGCTTCTCCTCTGGG + Intergenic
1025910659 7:65825901-65825923 ATGCCCACTCTCTCTCCTCTGGG - Intergenic
1031017291 7:116588588-116588610 CTGGACACTTCCTCTCCTTTAGG + Intergenic
1032377305 7:131433586-131433608 CTGGTTACTCCCTATCTTCTTGG + Intronic
1032493656 7:132344403-132344425 CTGGTCCCTCCCTTGCCTCTGGG - Intronic
1035313707 7:157985024-157985046 GTGGTCTCTAGCACTCCTCTTGG + Intronic
1043578296 8:81683087-81683109 CTGTTCACTTGTTCTCATCTTGG - Intronic
1049585848 8:143432080-143432102 CTGGGCCCTCCCACTCCTCTGGG + Intergenic
1052862690 9:33446693-33446715 CTGGTTACTCCCTGGCCTCTTGG - Intronic
1053372426 9:37574226-37574248 CTACTCACTCCCACTCCTCTTGG + Intronic
1055887051 9:81075827-81075849 CTTCTCTCTCTCTCTCCTCTTGG - Intergenic
1056382144 9:86065059-86065081 CTGGTCTCACGCTCTACGCTGGG + Intronic
1056925179 9:90828448-90828470 CTCATCACTCACTCTTCTCTGGG - Intronic
1057949270 9:99356828-99356850 CTGGCCACTGGCTCTTCCCTTGG + Intergenic
1060222946 9:121774002-121774024 AGGGTCACTCACTGTCCTCTTGG + Intronic
1061763081 9:132863851-132863873 CTGGTCCTTCCCTCTCCTATGGG + Intronic
1062462904 9:136669284-136669306 CCGGGCACACCCTCTCCTCTGGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186461769 X:9753847-9753869 CAAGTCCCCCGCTCTCCTCTCGG - Intronic
1189701515 X:43718899-43718921 CTGTCTACTCCCTCTCCTCTGGG - Intronic
1189716028 X:43867044-43867066 CTGGCCACTGGAGCTCCTCTTGG - Intronic
1192544759 X:72004387-72004409 CTGGTCACTGCCTGTCCCCTAGG - Intergenic
1197362297 X:125519851-125519873 CTGTTCAGTTGCTCTGCTCTGGG - Intergenic
1198429062 X:136547625-136547647 CTGGTCACTCACACAACTCTAGG - Intronic
1199034313 X:143032807-143032829 CTGGGCACTCACTCTTTTCTGGG - Intronic
1201018317 Y:9626240-9626262 CTGGTCATTCCTTCACCTCTGGG + Intergenic