ID: 984140872

View in Genome Browser
Species Human (GRCh38)
Location 4:176002340-176002362
Sequence CTGGTCACTCGCTCTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984140872_984140876 -10 Left 984140872 4:176002340-176002362 CCCAGAGGAGAGCGAGTGACCAG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 984140876 4:176002353-176002375 GAGTGACCAGACGCTGCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 56
984140872_984140882 30 Left 984140872 4:176002340-176002362 CCCAGAGGAGAGCGAGTGACCAG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 984140882 4:176002393-176002415 CGCTGAGGCTCCTCGCGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
984140872_984140879 15 Left 984140872 4:176002340-176002362 CCCAGAGGAGAGCGAGTGACCAG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 984140879 4:176002378-176002400 AAGTTCTCCAAGCCGCGCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984140872 Original CRISPR CTGGTCACTCGCTCTCCTCT GGG (reversed) Intronic