ID: 984140873 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:176002341-176002363 |
| Sequence | TCTGGTCACTCGCTCTCCTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 142 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 131} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984140873_984140882 | 29 | Left | 984140873 | 4:176002341-176002363 | CCAGAGGAGAGCGAGTGACCAGA | 0: 1 1: 0 2: 0 3: 10 4: 131 |
||
| Right | 984140882 | 4:176002393-176002415 | CGCTGAGGCTCCTCGCGCCCTGG | 0: 1 1: 0 2: 0 3: 11 4: 111 |
||||
| 984140873_984140879 | 14 | Left | 984140873 | 4:176002341-176002363 | CCAGAGGAGAGCGAGTGACCAGA | 0: 1 1: 0 2: 0 3: 10 4: 131 |
||
| Right | 984140879 | 4:176002378-176002400 | AAGTTCTCCAAGCCGCGCTGAGG | 0: 1 1: 0 2: 0 3: 6 4: 50 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984140873 | Original CRISPR | TCTGGTCACTCGCTCTCCTC TGG (reversed) | Intronic | ||