ID: 984140882

View in Genome Browser
Species Human (GRCh38)
Location 4:176002393-176002415
Sequence CGCTGAGGCTCCTCGCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984140872_984140882 30 Left 984140872 4:176002340-176002362 CCCAGAGGAGAGCGAGTGACCAG 0: 1
1: 0
2: 1
3: 13
4: 139
Right 984140882 4:176002393-176002415 CGCTGAGGCTCCTCGCGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
984140873_984140882 29 Left 984140873 4:176002341-176002363 CCAGAGGAGAGCGAGTGACCAGA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 984140882 4:176002393-176002415 CGCTGAGGCTCCTCGCGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
984140878_984140882 -6 Left 984140878 4:176002376-176002398 CCAAGTTCTCCAAGCCGCGCTGA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 984140882 4:176002393-176002415 CGCTGAGGCTCCTCGCGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
984140877_984140882 11 Left 984140877 4:176002359-176002381 CCAGACGCTGCGCGGGGCCAAGT 0: 1
1: 0
2: 24
3: 4
4: 44
Right 984140882 4:176002393-176002415 CGCTGAGGCTCCTCGCGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984140882 Original CRISPR CGCTGAGGCTCCTCGCGCCC TGG Intronic