ID: 984152421

View in Genome Browser
Species Human (GRCh38)
Location 4:176150983-176151005
Sequence TACTAGTTACCTCATCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984152421 Original CRISPR TACTAGTTACCTCATCCCTG GGG Intronic
908653107 1:66358143-66358165 GTCAAGTTACCTCATCCCTCTGG - Intronic
915718541 1:157966470-157966492 TTCTGGTATCCTCATCCCTGGGG - Intergenic
916455473 1:164966634-164966656 TAGTAGTTTCCTCATCTTTGTGG - Intergenic
916523732 1:165589787-165589809 TCCCAGTTACCTTATCTCTGTGG + Intergenic
918792374 1:188845813-188845835 TATTAGTTTCCTCATCATTGTGG - Intergenic
920743957 1:208607878-208607900 TAATATTTACCCCAGCCCTGAGG + Intergenic
923015411 1:230122550-230122572 TTCTGGTTTCCTTATCCCTGGGG - Intronic
923247636 1:232148176-232148198 TCCCAGTTACCTTCTCCCTGTGG + Intergenic
1064595771 10:16943142-16943164 GACCAGTTACTTCACCCCTGTGG - Intronic
1064595851 10:16944156-16944178 GACCAGTTACTTCACCCCTGCGG - Intronic
1064839128 10:19570503-19570525 TACTAATATCCTCTTCCCTGTGG + Intronic
1070827948 10:79402014-79402036 GACTAGTTGCCCCACCCCTGTGG - Intronic
1074695238 10:116044681-116044703 TCCTGGGTACCTCTTCCCTGAGG - Intergenic
1074978600 10:118600970-118600992 GACGAGTTACCTCCTCCCTTTGG - Intergenic
1078069282 11:8097755-8097777 TTCCAATTACCTCATCTCTGTGG + Exonic
1078136258 11:8654473-8654495 GACTAATTAACTCATCCCGGGGG - Exonic
1079573233 11:21970412-21970434 TACTAATCACCTTATGCCTGTGG - Intergenic
1085336287 11:75699132-75699154 TATTGGTCACCGCATCCCTGAGG - Intergenic
1085351192 11:75798775-75798797 CAAGAGTTACCTCCTCCCTGGGG - Intronic
1087691915 11:101330197-101330219 TTCTGGTGACCACATCCCTGTGG - Intergenic
1097712712 12:62933867-62933889 TACTATTTCCCTCAGCCCTTGGG - Intronic
1108428912 13:50334217-50334239 TACTAGTTACCTCCCCTCTGAGG + Intronic
1110289704 13:73789991-73790013 TTCTAGGTTCCTCATCTCTGAGG + Intronic
1110870949 13:80452064-80452086 TCCTAATTGCCACATCCCTGGGG + Intergenic
1121435832 14:93918807-93918829 TACTAGTGATGTCTTCCCTGAGG - Intergenic
1122536337 14:102466146-102466168 CACTGGTGTCCTCATCCCTGAGG - Intronic
1202900419 14_GL000194v1_random:33337-33359 TACTACTTTCCACATCCCAGGGG + Intergenic
1131014997 15:89050733-89050755 TCCCAGTTCCCTCAGCCCTGAGG + Intergenic
1139944629 16:70631812-70631834 GACAAGTTACCTCATCCCTCTGG + Intronic
1143234265 17:5384650-5384672 TACTACATACCTCATCTCTTGGG + Exonic
1148343455 17:46887854-46887876 CACTAATTGCTTCATCCCTGGGG - Intergenic
1149662101 17:58339378-58339400 TAACTGTCACCTCATCCCTGGGG - Intergenic
1153662221 18:7335059-7335081 TCCTTGTTGCCTCATGCCTGAGG + Intergenic
1156497270 18:37534171-37534193 AACTAGATACATCATCTCTGAGG - Intronic
1158109311 18:53922740-53922762 CACTAGGTACCTCATCTATGTGG - Intergenic
1158407458 18:57172858-57172880 TACTTGCAACCTCATCCATGTGG + Intergenic
1158407711 18:57175010-57175032 TACTTGCAACCTCATCCATGTGG + Intergenic
1158480810 18:57820173-57820195 CACTGGTGACCTCATCCCTCTGG + Intergenic
1159510651 18:69394788-69394810 TAATAGTTACCTCCTCAATGTGG - Intergenic
1163386284 19:17002115-17002137 TCCTGGTTCCCTCCTCCCTGGGG - Intronic
927256176 2:21043114-21043136 TCCTATTTACCTGACCCCTGGGG - Intronic
935672825 2:105570428-105570450 AACTTGTTAACTCAGCCCTGCGG + Intergenic
938647532 2:133346960-133346982 TTGTAGTTGCCTCATCACTGTGG + Intronic
1172372657 20:34406988-34407010 TTGTAGTTACCTCATCTATGAGG + Intronic
1174847355 20:53955622-53955644 TCCTAGTTTCCTCATCTCTATGG + Intronic
1176619793 21:9048115-9048137 TACTACTTTCCACATCCCAGGGG + Intergenic
951653891 3:24982738-24982760 TAATAGTTACACCATCCCTGGGG + Intergenic
952948728 3:38500044-38500066 TTCTAGTTCACTCTTCCCTGAGG - Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
956189116 3:66591695-66591717 TAATTTTTACCTCCTCCCTGTGG - Intergenic
956804983 3:72800729-72800751 TACTAGTTATAACATCTCTGTGG + Intronic
960867196 3:122213648-122213670 TAGTAGTTACCTGGACCCTGTGG + Intronic
962359192 3:134723075-134723097 TTCCAGTTACCTCATCCTTATGG + Intronic
964572519 3:158124306-158124328 TACTAGTAAACTCATGTCTGGGG - Intronic
965545426 3:169910531-169910553 CACTAGTTACGTGATTCCTGAGG + Intergenic
971679046 4:29673478-29673500 TAATAGTGACCTAATACCTGGGG - Intergenic
971915480 4:32865418-32865440 TACTCTTTGCCTAATCCCTGTGG - Intergenic
973697620 4:53506200-53506222 GGCTAGTTACCTAATCCCTCTGG + Intronic
984152421 4:176150983-176151005 TACTAGTTACCTCATCCCTGGGG + Intronic
986952550 5:13108069-13108091 TAGTAGGTAACTCATCACTGAGG - Intergenic
991055113 5:62311755-62311777 TAATAGTTCCCTTTTCCCTGAGG + Intronic
993423936 5:87738610-87738632 TACTCATCACCTCATGCCTGAGG + Intergenic
993912224 5:93697244-93697266 TACTAGTTTTCTCTTCCCTTTGG + Intronic
996776912 5:127142760-127142782 TCCTGGTTACCTCCTCCCGGGGG - Intergenic
997418333 5:133746917-133746939 TGCTTGTTACTTCATCCCTCTGG - Intergenic
998354081 5:141520142-141520164 TCCTAGTTTCCTCTTCCCTAAGG - Intronic
999466370 5:151809913-151809935 TAGTAGTAAACCCATCCCTGAGG - Exonic
1002075356 5:176705266-176705288 AACTAGTAACCTAGTCCCTGAGG - Intergenic
1007809575 6:44476411-44476433 TTCTAGTTTGCTCATCACTGAGG + Intergenic
1008075445 6:47140709-47140731 AACTAGTTTCTACATCCCTGAGG + Intergenic
1008488314 6:52058728-52058750 ACCCAGTTACCTCAGCCCTGTGG + Intronic
1008707700 6:54182602-54182624 TAATAGATAATTCATCCCTGAGG - Intronic
1016775841 6:147904099-147904121 TACTAGCTGTCTCATTCCTGTGG + Intergenic
1016937057 6:149455303-149455325 AACTAGTTACTGCACCCCTGTGG + Intronic
1019773311 7:2897177-2897199 TACTGGTGACCTCTTCCCTGAGG + Intergenic
1020018002 7:4842759-4842781 TCCTAGTCACTTCATCTCTGAGG - Intronic
1025783356 7:64621492-64621514 ATCTAGTGACCTCATCTCTGGGG - Intergenic
1028893001 7:96009750-96009772 TGCTGTTTACCTCATCACTGGGG + Intronic
1029447600 7:100622597-100622619 TACTAGCAACCTCAGCGCTGGGG + Intronic
1038719001 8:30016506-30016528 TACAAGTTCCCTGATCACTGAGG - Intergenic
1042024505 8:64408368-64408390 TCCTATTTTCCTCATCCTTGGGG + Intergenic
1042290997 8:67169327-67169349 AACTAGTTAACTGATTCCTGTGG - Intronic
1048854869 8:138677884-138677906 TACGAGTTAACTCATTCCAGAGG - Intronic
1049438016 8:142596582-142596604 TACTGGTTCCCTCATCAGTGAGG - Intergenic
1049532628 8:143162052-143162074 TACCTGTTCCCTCATCCCTTGGG - Intergenic
1050565408 9:6877062-6877084 TGCTGGGTACTTCATCCCTGAGG + Intronic
1053382826 9:37662592-37662614 TTCTAGATAGCTCCTCCCTGAGG - Intronic
1054354638 9:64049369-64049391 TACTACTTTCCACATCCCAGGGG + Intergenic
1055254061 9:74345058-74345080 TACTATTTTCCTCATCACTTGGG + Intergenic
1058337104 9:103843711-103843733 CACTTGTAACCTCATCCTTGTGG - Intergenic
1203742976 Un_GL000218v1:18493-18515 TACTACTTTCCACATCCCAGGGG + Intergenic
1186560887 X:10611850-10611872 TATTAGTTACATCATCCCTTCGG - Intronic
1192210283 X:69123488-69123510 TGCCAGTTCCCTCATCTCTGTGG - Intergenic
1196971111 X:121109721-121109743 TAGAAGTTTCCTTATCCCTGTGG - Intergenic
1200327194 X:155253197-155253219 TAATAGTTTCATCATTCCTGAGG + Intergenic
1201156502 Y:11135962-11135984 TACTACTTTCCACATCCCAGGGG + Intergenic
1201384036 Y:13418980-13419002 TCCTGGTTACCACTTCCCTGTGG + Intronic