ID: 984162876

View in Genome Browser
Species Human (GRCh38)
Location 4:176275531-176275553
Sequence CTGTGTAAACTGCTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984162876 Original CRISPR CTGTGTAAACTGCTGGAGAA AGG (reversed) Intronic
902863900 1:19265028-19265050 CTGTATAAAAGACTGGAGAAGGG - Intergenic
906439562 1:45829453-45829475 CTATGTACACTGCTGGACAAAGG - Exonic
906466828 1:46089159-46089181 CGGTGTAAAATGCAGGAAAATGG + Intronic
908662637 1:66453473-66453495 CTGTCAAAACTGATTGAGAATGG + Intergenic
909219877 1:72943835-72943857 CAGTGAAAACTGCTGGAATATGG - Intergenic
911466927 1:98266498-98266520 CTGTGCACACTGCTTGAAAAAGG - Intergenic
912436400 1:109664913-109664935 CTTAGTCAACTCCTGGAGAAAGG + Intronic
912937597 1:114017429-114017451 GTGTCTAAATTGCTGGAGGAAGG + Intergenic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
913159117 1:116129337-116129359 CTGTGCAGCCTGCTGGAGTAGGG + Intronic
918170619 1:181993757-181993779 TTCTGTAAACTGCTGGAGGCAGG - Intergenic
918674848 1:187270586-187270608 CACAGTAAAATGCTGGAGAAAGG - Intergenic
924238905 1:242022638-242022660 TTGAGCAAAGTGCTGGAGAATGG - Intergenic
1063477195 10:6339685-6339707 CAGTGTCCACTGATGGAGAATGG + Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1066680225 10:37930977-37930999 CTGTGACAGCTGATGGAGAAGGG - Intergenic
1067257120 10:44652176-44652198 CTTTGTAAACTGATGAAGTAGGG + Intergenic
1068375142 10:56168252-56168274 TTGTGTATGGTGCTGGAGAAAGG - Intergenic
1068738259 10:60439263-60439285 TTCTGTGAACTGCTAGAGAAGGG + Intronic
1069065571 10:63938604-63938626 ATGAGGAAAATGCTGGAGAAGGG + Intergenic
1069956227 10:72053662-72053684 CTGGGAACAATGCTGGAGAAGGG + Intergenic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1074789775 10:116875260-116875282 CTGTGTATGCTGGTGTAGAATGG - Intronic
1079087585 11:17457849-17457871 CTGTGCCAACTGCTGCAGGATGG + Intronic
1080447846 11:32353632-32353654 CTGTGTAGGAGGCTGGAGAATGG - Intergenic
1083429846 11:62608591-62608613 CTGTTGAAACTGCAGGAGATTGG - Exonic
1084690032 11:70719753-70719775 CCGTGTCAAATGCTGGAGCAGGG - Intronic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1088560166 11:111106662-111106684 CTGTCTATACTGCTGGACACTGG - Intergenic
1089628604 11:119769593-119769615 CTGTGCAAAATGCAGGGGAAGGG + Intergenic
1090009244 11:123031573-123031595 CTGTGTATGCTGATGGAGAGTGG + Intergenic
1090968084 11:131615845-131615867 CTGTGGAATCTGCTGCTGAATGG + Intronic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1093617065 12:21238571-21238593 TGGTGTAAGGTGCTGGAGAAGGG + Intronic
1094753700 12:33441367-33441389 CTGTGTAGACTGTAGCAGAATGG - Intergenic
1095989981 12:48027829-48027851 CTGTGTAAACTCCTGGAGGCAGG + Intergenic
1096201145 12:49684143-49684165 TTGTGTTAAGAGCTGGAGAAAGG - Intronic
1100018190 12:90037606-90037628 GTTTATAAACTGCTTGAGAAGGG - Intergenic
1101028001 12:100632768-100632790 CTCTGTCATCTGCTGGAGCAGGG - Intergenic
1103335823 12:120188874-120188896 CTCTGTATACTACTTGAGAAAGG + Intronic
1107607168 13:42070729-42070751 TTGTCTAAAGTGCTGGAGCAGGG - Intronic
1108404133 13:50082500-50082522 CCCTGTAAAGCGCTGGAGAACGG - Exonic
1108418762 13:50227801-50227823 CTGTGGAAACTGCTGGTGGGTGG + Intronic
1108501363 13:51072515-51072537 CTGTGAAGTCTGGTGGAGAAAGG - Intergenic
1108555178 13:51584612-51584634 CTGAGGAGACTGCTGGAGCACGG - Exonic
1110133021 13:72029981-72030003 ATGTATGAACTGCTGGACAAAGG + Intergenic
1112049979 13:95635644-95635666 CTGTGTACAGCACTGGAGAAAGG + Intronic
1112461033 13:99604040-99604062 CTCTGAGAACTGCTGGGGAAAGG + Intergenic
1112578696 13:100659974-100659996 CAGTGTGAAATGCTGGAGAGTGG + Intronic
1113395003 13:109939282-109939304 CTGTTTAAAAGGCTAGAGAAAGG - Intergenic
1113863377 13:113505923-113505945 CTGTGTACACTCCTGAAGACAGG + Intronic
1114162726 14:20187335-20187357 CTCTGCACACTGCTGCAGAATGG + Intergenic
1118367631 14:65109228-65109250 CTGTGGCTACTGGTGGAGAATGG - Intergenic
1118849061 14:69571115-69571137 CTGGGGCAACTGCTGCAGAAGGG + Exonic
1118952366 14:70446440-70446462 CTGTGTTAATTGCTGAAAAATGG + Intergenic
1119382624 14:74239018-74239040 CTGTGTAAACGGTTGAACAAGGG - Intergenic
1119638629 14:76297022-76297044 TTGTGTAAAGTGCTGCAAAATGG + Intergenic
1119751741 14:77083520-77083542 CGGTGTAAACTGCAGCATAAAGG + Intergenic
1120960153 14:90117195-90117217 CAGTGTATACAGCTGGACAAAGG + Intronic
1121593536 14:95139038-95139060 TTGTGGAAATTGCTGGTGAATGG - Intronic
1126210576 15:46097060-46097082 CTGTGTATGCTGCAGTAGAAGGG - Intergenic
1126645308 15:50869597-50869619 CTGTGTAAACTGCCATAGCATGG - Intergenic
1127058298 15:55154914-55154936 CTCAGAAAGCTGCTGGAGAATGG + Intergenic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1129125537 15:73437700-73437722 CTGTGTATACTGTGTGAGAAGGG - Intergenic
1130063189 15:80584193-80584215 ATGAGTACACTGCTGGAGGAAGG + Intronic
1130520309 15:84656840-84656862 CTGTGTAGACTGGGGGAGAAAGG + Intronic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1132915827 16:2342748-2342770 CTGTGAAGACTGATGGGGAAAGG - Intergenic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136452642 16:30362367-30362389 CTGTGTGAAATGCTGCTGAAGGG - Intronic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1137669121 16:50269175-50269197 CTCTGTAAACTGGAGGTGAACGG - Intronic
1138794531 16:59952151-59952173 CTGTGTAAACTCCCTGAGAACGG - Intergenic
1140153399 16:72396516-72396538 CTCTGGTAATTGCTGGAGAAAGG - Intergenic
1142130148 16:88428569-88428591 TTGTGTAAACTGTCAGAGAAGGG - Exonic
1144262901 17:13540512-13540534 CTATTTAAACTACTGGAAAAAGG - Intronic
1146613529 17:34331920-34331942 CTGGATAAACTGCTGAAGGATGG - Intergenic
1147566611 17:41540346-41540368 CTATATAAACTGCTGGAGGTAGG - Intergenic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1149191677 17:54070677-54070699 CTGTGTAATCTGCTCTTGAATGG - Intergenic
1149566812 17:57646019-57646041 CTGGGTAAACTGCAGCTGAAAGG - Intronic
1151727587 17:75893711-75893733 CTGTGTGAAATGCTGGAGGCTGG - Intronic
1153906365 18:9665245-9665267 GTTTCTAAACAGCTGGAGAAAGG + Intergenic
1157056609 18:44236535-44236557 CTGTGAAAACTTCAGGATAAAGG + Intergenic
1157214938 18:45774873-45774895 CTACCTAAAATGCTGGAGAATGG + Intergenic
1157514634 18:48302115-48302137 CAGCGTCAACTCCTGGAGAAGGG - Intronic
1158818949 18:61136120-61136142 CAGTGTAAAATACTGGAGCAAGG + Intergenic
1159001935 18:62982081-62982103 CTGTGTCTGCTGCAGGAGAAAGG + Intergenic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1160234951 18:77078442-77078464 CTGTGACAACTTCTGGAGAAGGG + Intronic
1160853783 19:1206815-1206837 CTTTGTAAAATTTTGGAGAAGGG + Exonic
1161707448 19:5828853-5828875 CTGTGTGGACTTCTGGAGAGGGG + Intergenic
1162360913 19:10219939-10219961 TTGTCTCAACTGCTAGAGAAGGG + Intronic
1164702933 19:30298528-30298550 CTTTGTCAACTGCAGAAGAACGG + Intronic
926948925 2:18220214-18220236 CTGTGTAATATGCTGTAGATGGG + Intronic
928023906 2:27724297-27724319 GTGAGAAAACTGCTGGAGAAAGG - Intergenic
929244922 2:39690802-39690824 CTCTGTAAACTACAAGAGAACGG + Intronic
929676319 2:43934777-43934799 TTGTGTAAACTGGTAGAGAAAGG - Exonic
930308623 2:49709278-49709300 CTGTGTCAAATGGTGCAGAAAGG - Intergenic
930327740 2:49941698-49941720 CTGTGTAAAATACTGAAAAATGG + Intronic
930854431 2:55997490-55997512 CTGTGGAAACTGCAAGAGAGAGG - Intergenic
931240135 2:60445006-60445028 CTGAGTTAAGTGCTGGGGAAGGG - Intergenic
932062601 2:68522736-68522758 CAGTTCAAACTGATGGAGAAAGG + Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
933381082 2:81546582-81546604 CTCTGGAAGCTGCTGGAGAAAGG + Intergenic
939228016 2:139388142-139388164 CTGTGTGCACTGCTGGTGACTGG - Intergenic
939500104 2:142973893-142973915 CTGTGTTAAGTGCTTGACAACGG + Intronic
942975877 2:182016227-182016249 ATGTGGTCACTGCTGGAGAATGG + Intronic
943265235 2:185722445-185722467 GTATGTAAACTGCTCAAGAATGG - Intergenic
944556204 2:200890021-200890043 ATGTAGAAAATGCTGGAGAATGG + Intronic
1170867525 20:20172694-20172716 CTGTGTATGGTGGTGGAGAAGGG - Intronic
1171338588 20:24409421-24409443 CTGTGTAAACTGCTGGCTTCAGG - Intergenic
1174985905 20:55451731-55451753 CTGTGTGAACCCCTAGAGAAAGG - Intergenic
1175028071 20:55924085-55924107 CTGTGGTAGCTGCTGGAGACCGG - Intergenic
1175401964 20:58706156-58706178 GTGTGGACACTGCAGGAGAAGGG + Intronic
1175441614 20:58996305-58996327 CTGTGAGCACTGCTGGAGAGGGG - Intronic
1175530171 20:59669290-59669312 CTGTGTTAACTACTGAAGATGGG + Intronic
1181075512 22:20373461-20373483 CTCTGCAAAATGCTGGAGAGAGG - Intronic
1181140004 22:20797403-20797425 CTGGGGACACTCCTGGAGAAAGG + Intronic
1182528062 22:30933948-30933970 TTGTGTAGACTGCTGGTGGATGG + Intronic
1183865222 22:40699003-40699025 CTGTGGGAACTTCTGGAAAAAGG + Intergenic
1183972756 22:41490442-41490464 CTTTGTAAACAGCTGTAGAGTGG + Intronic
949339308 3:3011383-3011405 CTGTGAAAAATGCTGAAGACAGG - Intronic
949588317 3:5465729-5465751 CTTTGTAAACTGGAGGTGAAGGG + Intergenic
949764692 3:7513222-7513244 CTGTGAAAACACCAGGAGAAAGG - Intronic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
951559230 3:23949021-23949043 CCATGTAAATTACTGGAGAAGGG - Intronic
952344440 3:32470750-32470772 CAGTGTGAACTGCTGGTGTATGG + Intronic
954197050 3:49003096-49003118 CTGTGCTAACTGCTGGGGAGGGG + Intronic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
956931235 3:74045755-74045777 TTGGGAAAACTGTTGGAGAAGGG + Intergenic
957507296 3:81138711-81138733 CTATGTACAGTGCTGGGGAATGG - Intergenic
958154874 3:89743728-89743750 CTGTGTAAAATGCTGATGATAGG - Intergenic
960005195 3:112774724-112774746 CTGTGTCCACCGCTGGGGAATGG - Intronic
960269078 3:115654820-115654842 CTGTGTACATTTCTGGAAAATGG - Intronic
960869513 3:122234499-122234521 GTTTGGAAACTGCTGGAGGATGG + Intronic
962246486 3:133799369-133799391 CTATATGAACTGCTGGGGAAAGG + Intronic
962499334 3:135974056-135974078 CTGTGTAAAATGCTGCTGAAAGG - Intronic
962940906 3:140124102-140124124 CAGTATGAACTGCTGGAGAAAGG + Intronic
963306197 3:143656007-143656029 ATGAGAAAACTGCTGGAGCAAGG + Intronic
964467531 3:157012638-157012660 CTGTGTACCCTGATGGACAAGGG - Intronic
966875436 3:184319194-184319216 CTTTGTAAAGGGCTGGAGACAGG + Intronic
967980743 3:195063642-195063664 CTGTGGAGAATGCGGGAGAAGGG + Intergenic
970020974 4:11568219-11568241 CTGTAAAAACTGCTTGAGACTGG + Intergenic
970265600 4:14280722-14280744 CTGTGTCAAATGCTGATGAAAGG + Intergenic
972574618 4:40340210-40340232 CTGTGTAAAGGGGTGGAGAGTGG - Intronic
972628627 4:40824345-40824367 CTGTGGAAACAGCTGGCAAAAGG - Intronic
974286366 4:59872688-59872710 GTGTGTACACTGCTTGAAAATGG + Intergenic
974468499 4:62289048-62289070 CTTTATAAATTGCTGGAGAATGG + Intergenic
974627392 4:64442533-64442555 CTGTGTAAACTGCCATAGCATGG - Intergenic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
976333930 4:83863930-83863952 CTGTGTAAATTGCTGAAGAATGG + Intergenic
977483332 4:97608102-97608124 CTCTTCACACTGCTGGAGAAAGG + Intronic
977725529 4:100292569-100292591 CTGTGTCAACTGCTGCTGATAGG - Intergenic
980888669 4:138790500-138790522 CTGTCTGAATTGCTGGAAAATGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
984456157 4:179972030-179972052 CTGTGTTAATTCCTTGAGAATGG + Intergenic
987043149 5:14082054-14082076 CTGAGAAAACTGCTGGAGTTTGG + Intergenic
992257992 5:74941318-74941340 CTGTGTTAAATGCTGGTGATGGG + Intergenic
993453756 5:88103948-88103970 ATGTGAAAACTGCTAGAGAATGG + Intergenic
993539494 5:89130988-89131010 CTGTGTAAACTGGTGAAAACAGG - Intergenic
993680543 5:90872760-90872782 CTCTGTAAAGGGGTGGAGAAGGG - Intronic
996003638 5:118393611-118393633 CTATGTAAACTCCTTGAGAAAGG - Intergenic
996703652 5:126475079-126475101 CAGGGTAAACTGCTTTAGAAGGG - Intronic
997153769 5:131528873-131528895 CTGTGTCAAGTGCTGCAGATAGG + Intronic
998665709 5:144295026-144295048 GTATGTAAACTGCTGGGGATAGG + Intronic
1000980883 5:167815567-167815589 CTGTGAACACTTCTGGGGAATGG + Intronic
1001557166 5:172644670-172644692 CTCTTTAAAATGGTGGAGAATGG - Intronic
1001697402 5:173681836-173681858 CTGTTTAAATTGTTGAAGAATGG - Intergenic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1003312810 6:4984128-4984150 CAGTGTAACCTGCTGGATCATGG - Intergenic
1004261278 6:14109707-14109729 CTGTGTAAACTTCTTGAGAATGG + Intergenic
1004268635 6:14173525-14173547 CTCTGGCTACTGCTGGAGAATGG + Intergenic
1004692524 6:18004650-18004672 TTGTGGAACCTGGTGGAGAAAGG + Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1005350724 6:24932712-24932734 CTGTGTAACCTCTAGGAGAAAGG + Intronic
1005880428 6:30054202-30054224 ATTTGTTAACTGCTGGAGACAGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007001401 6:38317292-38317314 ATGTTTAAACTGCTGAAGGAAGG - Intronic
1007464812 6:42044266-42044288 GTGTGTAAACAGCTGGTGATGGG + Intronic
1008721723 6:54361969-54361991 GTGAGTAAGCTGCTGAAGAAAGG + Intronic
1009052483 6:58293071-58293093 TTGAGCAAACTGCTGGGGAAGGG + Intergenic
1009238626 6:61157543-61157565 TTGAGCAAACTGCTGGGGAAGGG - Intergenic
1011514896 6:88143655-88143677 CACTGTAAACCCCTGGAGAATGG + Exonic
1013381812 6:109580338-109580360 GTTAGTAAAATGCTGGAGAAAGG + Intronic
1013504186 6:110782744-110782766 GTGTTTAACCTGATGGAGAAAGG - Intronic
1014167812 6:118245676-118245698 CTGTGTATCCTGCCTGAGAAGGG - Intronic
1016133434 6:140507011-140507033 CAATTTAAACTGCTAGAGAATGG - Intergenic
1016680159 6:146820149-146820171 CTGAGAAAAATGCTGGCGAAAGG - Intergenic
1018428316 6:163702866-163702888 CTGTGTCTATTGCTGCAGAAAGG + Intergenic
1019447502 7:1078996-1079018 CTGTCAAGACTGCTGGTGAATGG + Intronic
1019447513 7:1079055-1079077 CTGTCAAGACTGCTGGTGAATGG + Intronic
1019765628 7:2848009-2848031 CTCTCTACACTGCTGGGGAAAGG + Intergenic
1022779098 7:33560029-33560051 CTGGGTAAACTGATAGAGAGGGG - Intronic
1024119595 7:46223256-46223278 CTGTGTCAAATGCTGCTGAAAGG + Intergenic
1024788989 7:52940947-52940969 ATGTGAGGACTGCTGGAGAAGGG + Intergenic
1026032321 7:66805011-66805033 CTAAGTTAACTGCTGGAAAAGGG + Intronic
1028658304 7:93236164-93236186 CTGTGTTAAATGCTGCAGATTGG + Intronic
1028820016 7:95198054-95198076 ATGTGTAAAGTACTGCAGAATGG + Intronic
1029465421 7:100721711-100721733 CTGTGGAATGTGCTGGGGAAGGG - Intronic
1030278205 7:107742983-107743005 AAGTGTAAAAGGCTGGAGAAAGG + Intergenic
1030845365 7:114402431-114402453 TTGTGTAAACTGTTTGAGATAGG - Intronic
1031998274 7:128247132-128247154 CTTTGGAAACTTCTGGAGAGAGG + Intronic
1032319133 7:130868737-130868759 CTGTTTTAACAGCTGTAGAATGG + Intergenic
1032978635 7:137254875-137254897 CTGTGGATACTGCTGAAGCAGGG - Exonic
1034202386 7:149290519-149290541 CTGTGTAAGGTGCTAGAGGAGGG - Intronic
1034958198 7:155349019-155349041 CTGTCTGACCTGGTGGAGAATGG + Intergenic
1039417794 8:37410346-37410368 CTCTTCAAGCTGCTGGAGAATGG - Intergenic
1042194881 8:66223415-66223437 CAGTGTCAACTGCAGGAGATGGG + Intergenic
1042230902 8:66553377-66553399 ATGAGTAAAAGGCTGGAGAATGG - Intergenic
1043809942 8:84726868-84726890 CTGTGTAAACTTCTTGAGGATGG - Intronic
1046726372 8:117678870-117678892 CTGTTGAAACTTCTGCAGAAGGG - Intergenic
1047967003 8:130052645-130052667 CTGTGTAAGTTGCTGCAAAAGGG + Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1051253700 9:15189725-15189747 ATTTGGAAACTGCTGGAGGAAGG + Exonic
1051403094 9:16704876-16704898 TTGTGTAAACTGCCTGAGAGCGG - Intronic
1051714357 9:19965843-19965865 CTGTGTAATCTTCTTGAGACTGG + Intergenic
1051741529 9:20257181-20257203 CTGTGTATACTGCTGAACAAGGG - Intergenic
1056976622 9:91262591-91262613 GTGTATAAAGTGCTTGAGAATGG - Intronic
1057704055 9:97385451-97385473 GTGTGTTGACTGCAGGAGAAGGG - Intergenic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1059585300 9:115599576-115599598 CTGTGCTAAGTGCTGAAGAAAGG + Intergenic
1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG + Intronic
1186084895 X:5976793-5976815 CTCTGTAAACTGCTGGTCAAGGG - Intronic
1186911809 X:14175032-14175054 CTATGCACACTGCTGGGGAATGG + Intergenic
1188286811 X:28336558-28336580 CTGTAAAAGCTGCTGGAGCAGGG + Intergenic
1188734044 X:33690367-33690389 CTGTGGAAACTGTTGAAGCATGG - Intergenic
1191693479 X:63964428-63964450 CTGTGTAAATAGCTGAAGGAAGG - Intergenic
1192916919 X:75661785-75661807 CCGTGTAAACTCCTCAAGAATGG - Intergenic
1194113221 X:89864096-89864118 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1194564961 X:95474127-95474149 CAGTGTCAACTGCAGGAGAGAGG - Intergenic
1194755176 X:97730959-97730981 CTGTGTTAAATGCTCTAGAAAGG - Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1198553085 X:137764708-137764730 CTGTGAGTACTTCTGGAGAATGG - Intergenic
1198852227 X:140977166-140977188 CTGTGAAAAATGCTGTGGAACGG + Intergenic
1198891906 X:141405962-141405984 CTGTGTTTTCTGCTGGAAAAAGG - Intergenic
1198920612 X:141721859-141721881 CTGTGTCATCTCCTGGTGAAAGG + Intergenic
1199531036 X:148847902-148847924 CTGTGTACACTTCAGGAGGAAGG - Intronic
1199905357 X:152223187-152223209 GTGTCTAAAATTCTGGAGAAAGG - Intronic
1200465906 Y:3519155-3519177 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1201701009 Y:16882352-16882374 CTGTGTAACATGGTGGAGTAGGG - Intergenic