ID: 984164334

View in Genome Browser
Species Human (GRCh38)
Location 4:176289265-176289287
Sequence GGTGCTAGTGTGACACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984164334_984164345 26 Left 984164334 4:176289265-176289287 CCCTCTTGTGTCACACTAGCACC No data
Right 984164345 4:176289314-176289336 TTTGCCAAGTGTACCCTAAGGGG No data
984164334_984164343 24 Left 984164334 4:176289265-176289287 CCCTCTTGTGTCACACTAGCACC No data
Right 984164343 4:176289312-176289334 TGTTTGCCAAGTGTACCCTAAGG No data
984164334_984164344 25 Left 984164334 4:176289265-176289287 CCCTCTTGTGTCACACTAGCACC No data
Right 984164344 4:176289313-176289335 GTTTGCCAAGTGTACCCTAAGGG No data
984164334_984164338 -2 Left 984164334 4:176289265-176289287 CCCTCTTGTGTCACACTAGCACC No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984164334 Original CRISPR GGTGCTAGTGTGACACAAGA GGG (reversed) Intergenic
No off target data available for this crispr