ID: 984164338

View in Genome Browser
Species Human (GRCh38)
Location 4:176289286-176289308
Sequence CCTATTGAGGCCCTTCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984164335_984164338 -3 Left 984164335 4:176289266-176289288 CCTCTTGTGTCACACTAGCACCT No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
984164332_984164338 18 Left 984164332 4:176289245-176289267 CCTATAATGAATTCCTCATTCCC No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
984164334_984164338 -2 Left 984164334 4:176289265-176289287 CCCTCTTGTGTCACACTAGCACC No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
984164329_984164338 24 Left 984164329 4:176289239-176289261 CCTTCCCCTATAATGAATTCCTC No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
984164330_984164338 20 Left 984164330 4:176289243-176289265 CCCCTATAATGAATTCCTCATTC No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
984164333_984164338 5 Left 984164333 4:176289258-176289280 CCTCATTCCCTCTTGTGTCACAC No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
984164331_984164338 19 Left 984164331 4:176289244-176289266 CCCTATAATGAATTCCTCATTCC No data
Right 984164338 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984164338 Original CRISPR CCTATTGAGGCCCTTCGCCC TGG Intergenic
No off target data available for this crispr