ID: 984164343

View in Genome Browser
Species Human (GRCh38)
Location 4:176289312-176289334
Sequence TGTTTGCCAAGTGTACCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984164335_984164343 23 Left 984164335 4:176289266-176289288 CCTCTTGTGTCACACTAGCACCT No data
Right 984164343 4:176289312-176289334 TGTTTGCCAAGTGTACCCTAAGG No data
984164340_984164343 -8 Left 984164340 4:176289297-176289319 CCTTCGCCCTGGAAATGTTTGCC No data
Right 984164343 4:176289312-176289334 TGTTTGCCAAGTGTACCCTAAGG No data
984164339_984164343 -7 Left 984164339 4:176289296-176289318 CCCTTCGCCCTGGAAATGTTTGC No data
Right 984164343 4:176289312-176289334 TGTTTGCCAAGTGTACCCTAAGG No data
984164334_984164343 24 Left 984164334 4:176289265-176289287 CCCTCTTGTGTCACACTAGCACC No data
Right 984164343 4:176289312-176289334 TGTTTGCCAAGTGTACCCTAAGG No data
984164337_984164343 3 Left 984164337 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
Right 984164343 4:176289312-176289334 TGTTTGCCAAGTGTACCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984164343 Original CRISPR TGTTTGCCAAGTGTACCCTA AGG Intergenic
No off target data available for this crispr