ID: 984164344

View in Genome Browser
Species Human (GRCh38)
Location 4:176289313-176289335
Sequence GTTTGCCAAGTGTACCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984164335_984164344 24 Left 984164335 4:176289266-176289288 CCTCTTGTGTCACACTAGCACCT No data
Right 984164344 4:176289313-176289335 GTTTGCCAAGTGTACCCTAAGGG No data
984164340_984164344 -7 Left 984164340 4:176289297-176289319 CCTTCGCCCTGGAAATGTTTGCC No data
Right 984164344 4:176289313-176289335 GTTTGCCAAGTGTACCCTAAGGG No data
984164334_984164344 25 Left 984164334 4:176289265-176289287 CCCTCTTGTGTCACACTAGCACC No data
Right 984164344 4:176289313-176289335 GTTTGCCAAGTGTACCCTAAGGG No data
984164337_984164344 4 Left 984164337 4:176289286-176289308 CCTATTGAGGCCCTTCGCCCTGG No data
Right 984164344 4:176289313-176289335 GTTTGCCAAGTGTACCCTAAGGG No data
984164339_984164344 -6 Left 984164339 4:176289296-176289318 CCCTTCGCCCTGGAAATGTTTGC No data
Right 984164344 4:176289313-176289335 GTTTGCCAAGTGTACCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984164344 Original CRISPR GTTTGCCAAGTGTACCCTAA GGG Intergenic
No off target data available for this crispr