ID: 984165094

View in Genome Browser
Species Human (GRCh38)
Location 4:176296617-176296639
Sequence AGGGTGAGGAATAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984165087_984165094 13 Left 984165087 4:176296581-176296603 CCTGGTGAAACTACTATCAATAA No data
Right 984165094 4:176296617-176296639 AGGGTGAGGAATAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984165094 Original CRISPR AGGGTGAGGAATAGGGAAGA AGG Intergenic
No off target data available for this crispr