ID: 984165946

View in Genome Browser
Species Human (GRCh38)
Location 4:176303481-176303503
Sequence TTGTTCCAAGGTAAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984165946_984165952 -5 Left 984165946 4:176303481-176303503 CCCCAAAACTTACCTTGGAACAA No data
Right 984165952 4:176303499-176303521 AACAAAGGGATGAAAGCAGCTGG No data
984165946_984165953 16 Left 984165946 4:176303481-176303503 CCCCAAAACTTACCTTGGAACAA No data
Right 984165953 4:176303520-176303542 GGAAACATCTCCTTCATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984165946 Original CRISPR TTGTTCCAAGGTAAGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr