ID: 984165953

View in Genome Browser
Species Human (GRCh38)
Location 4:176303520-176303542
Sequence GGAAACATCTCCTTCATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984165951_984165953 4 Left 984165951 4:176303493-176303515 CCTTGGAACAAAGGGATGAAAGC No data
Right 984165953 4:176303520-176303542 GGAAACATCTCCTTCATGAGTGG No data
984165948_984165953 14 Left 984165948 4:176303483-176303505 CCAAAACTTACCTTGGAACAAAG No data
Right 984165953 4:176303520-176303542 GGAAACATCTCCTTCATGAGTGG No data
984165944_984165953 22 Left 984165944 4:176303475-176303497 CCATTTCCCCAAAACTTACCTTG No data
Right 984165953 4:176303520-176303542 GGAAACATCTCCTTCATGAGTGG No data
984165946_984165953 16 Left 984165946 4:176303481-176303503 CCCCAAAACTTACCTTGGAACAA No data
Right 984165953 4:176303520-176303542 GGAAACATCTCCTTCATGAGTGG No data
984165947_984165953 15 Left 984165947 4:176303482-176303504 CCCAAAACTTACCTTGGAACAAA No data
Right 984165953 4:176303520-176303542 GGAAACATCTCCTTCATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984165953 Original CRISPR GGAAACATCTCCTTCATGAG TGG Intergenic
No off target data available for this crispr