ID: 984167693

View in Genome Browser
Species Human (GRCh38)
Location 4:176321471-176321493
Sequence TAGTATCCCCTTAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984167688_984167693 10 Left 984167688 4:176321438-176321460 CCGTAGTAAACAGTAAATAGCAG 0: 1
1: 0
2: 1
3: 12
4: 232
Right 984167693 4:176321471-176321493 TAGTATCCCCTTAATGGGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984167693 Original CRISPR TAGTATCCCCTTAATGGGGT AGG Intronic
900518684 1:3095417-3095439 TGGTATCCCCCTCCTGGGGTGGG + Intronic
903446578 1:23426099-23426121 CAGTATCCCCTCAGTGGGGTTGG + Intergenic
913602020 1:120430043-120430065 AAATCTGCCCTTAATGGGGTTGG - Intergenic
913992154 1:143624390-143624412 AAATCTGCCCTTAATGGGGTTGG + Intergenic
914085023 1:144446560-144446582 AAATCTGCCCTTAATGGGGTTGG + Intronic
914363204 1:146953685-146953707 AAATCTGCCCTTAATGGGGTTGG - Intronic
914488475 1:148133457-148133479 AAATCTGCCCTTAATGGGGTTGG + Intronic
916293436 1:163190852-163190874 GGGTATCCCTTTAATGGGCTAGG - Intronic
921535973 1:216349685-216349707 TAGTTTTCCCTGAAAGGGGTGGG - Intronic
921855834 1:219983506-219983528 TAACATCCCCTTAATGTGGGAGG + Intronic
1063068192 10:2631410-2631432 TAGTCTCCCATTGATGAGGTTGG + Intergenic
1063827175 10:9911039-9911061 AAGTATCCCCTCAATGTTGTTGG + Intergenic
1073820707 10:107260463-107260485 TATTTTCCCCTTAATATGGTTGG - Intergenic
1078897879 11:15613959-15613981 TAGTATTTACTTCATGGGGTTGG + Intergenic
1079433490 11:20420838-20420860 TAGGATCTCCTTTATGGTGTTGG - Intronic
1085676571 11:78525684-78525706 TAGTCTCCCCTCACTGGGGATGG - Intronic
1091990206 12:4948985-4949007 CAGTATCCCCAAAATGGGTTTGG - Intergenic
1103717867 12:122956257-122956279 TAGTACCCCTCCAATGGGGTTGG - Intronic
1109279723 13:60342026-60342048 TAGCACCCCATGAATGGGGTTGG + Intergenic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1112415226 13:99198982-99199004 TTGCATCCCCTTAATGGGTCAGG + Intergenic
1112750088 13:102574068-102574090 TAGTAGCTGCTTCATGGGGTTGG - Intergenic
1114863831 14:26562321-26562343 TAGTATGCGTTTAATGGGATTGG + Intronic
1119644596 14:76339305-76339327 TAGTATCCCCGTTATGGAGATGG - Intronic
1120096320 14:80392356-80392378 TAGTATTCCCTTAATGTGCTTGG - Intergenic
1121269857 14:92630900-92630922 TAACATCCCCTTGATGGGGGAGG - Intronic
1124159016 15:27252513-27252535 TAGTATCCCCTGGCTGGGGTGGG - Intronic
1124818212 15:33018100-33018122 TACCATCACCTTAAGGGGGTAGG - Intronic
1126620141 15:50630359-50630381 CAGTATCCTCTTAATGTGCTGGG + Intronic
1127007646 15:54588405-54588427 TAGTGTCCCCTAAATGTGGTTGG + Intronic
1131341145 15:91602283-91602305 TTGTAACCCCATAATGGGATTGG - Intergenic
1141049222 16:80745531-80745553 CAGTACCCCCTTCATGGAGTTGG + Intronic
1144043180 17:11430989-11431011 TAGTCTCCCCTCACTGGGCTGGG + Intronic
1145101902 17:20084609-20084631 CAGTATCCCATTAATCAGGTGGG + Intronic
934976454 2:98806087-98806109 TAGTATATCCATCATGGGGTGGG + Intronic
1183318484 22:37149576-37149598 TAGCCTCCCCTGAATGGGTTGGG + Intronic
1185264935 22:49896375-49896397 TAGTATCCTCCTATTGAGGTGGG + Intergenic
955849059 3:63199973-63199995 TAGTATCTAATTTATGGGGTTGG - Intergenic
962371076 3:134821212-134821234 TTGTTTCCCCTTAATGTGGGTGG - Intronic
964722448 3:159780715-159780737 TAGTGTCCACTTAATGGGATGGG + Intronic
966678831 3:182618827-182618849 TAGTATCCCCTAAATAGTCTGGG - Intergenic
968469897 4:775166-775188 TAGGACCCCCTTTATGGTGTGGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
984167693 4:176321471-176321493 TAGTATCCCCTTAATGGGGTAGG + Intronic
986031263 5:3894795-3894817 TAGTATCCAATTAATGTAGTTGG + Intergenic
989536769 5:42573259-42573281 TAGTATCCCCTTATAGTGGGAGG + Intronic
990605541 5:57406125-57406147 TTTTATCCCCTTGATGGTGTGGG + Intergenic
1003064139 6:2888688-2888710 GAGTATCTGCTTAATGGGATGGG + Exonic
1005386414 6:25289695-25289717 CAGTATCCCCTTTTTGGGATTGG + Intronic
1007070546 6:39034661-39034683 CAGTATCCATTTCATGGGGTTGG - Intergenic
1008522605 6:52376653-52376675 AAGTATACAATTAATGGGGTGGG - Intronic
1013545138 6:111149228-111149250 TAGTTTCTCCTGATTGGGGTGGG - Intronic
1016309056 6:142714000-142714022 CAGCATCCCCTAAAGGGGGTTGG - Intergenic
1021521989 7:21548089-21548111 TAATAACCCATTAATGGGTTGGG - Intronic
1041635907 8:60144012-60144034 AATTATCCCCTCAATGGTGTGGG + Intergenic
1050512487 9:6411080-6411102 TAGTTTCGCCTTATTGAGGTAGG + Intergenic
1057609899 9:96532363-96532385 TGGTATCCCCTGTATGTGGTAGG + Intronic
1061652880 9:132065499-132065521 CAGGAGCCCCTTACTGGGGTGGG - Intronic
1062485932 9:136775641-136775663 CAGGATCCCCTTTCTGGGGTGGG - Intergenic
1187984448 X:24795378-24795400 TTGTATACCCTCAATGGTGTTGG + Intronic
1188234011 X:27704333-27704355 TAGTATCTCCTTTATGAGGCTGG - Intronic
1189094516 X:38124084-38124106 TGGTATCCACCTAATGGGTTAGG + Intronic
1189118194 X:38365619-38365641 GAGTATCCCCTTCATGGGGGAGG - Intronic
1189890591 X:45598073-45598095 TAGTATCCCCTTATTTGTGGAGG + Intergenic
1189890651 X:45598691-45598713 TAGTATCCCCTTATTTGTGGAGG - Intergenic
1196109047 X:111926667-111926689 TATTATCTCCTTTATGAGGTAGG + Intronic