ID: 984168455

View in Genome Browser
Species Human (GRCh38)
Location 4:176332255-176332277
Sequence TTTCTAATGTGACCAAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984168453_984168455 11 Left 984168453 4:176332221-176332243 CCAATAAATATTGATGAAGAATG 0: 1
1: 0
2: 0
3: 37
4: 352
Right 984168455 4:176332255-176332277 TTTCTAATGTGACCAAACCATGG 0: 1
1: 0
2: 0
3: 21
4: 158
984168452_984168455 12 Left 984168452 4:176332220-176332242 CCCAATAAATATTGATGAAGAAT 0: 1
1: 0
2: 10
3: 70
4: 660
Right 984168455 4:176332255-176332277 TTTCTAATGTGACCAAACCATGG 0: 1
1: 0
2: 0
3: 21
4: 158
984168451_984168455 30 Left 984168451 4:176332202-176332224 CCTTGCACATAATAGGCGCCCAA 0: 1
1: 1
2: 12
3: 168
4: 1312
Right 984168455 4:176332255-176332277 TTTCTAATGTGACCAAACCATGG 0: 1
1: 0
2: 0
3: 21
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984168455 Original CRISPR TTTCTAATGTGACCAAACCA TGG Intergenic
901876147 1:12168031-12168053 TATCTTATCTTACCAAACCATGG - Intronic
906786352 1:48619398-48619420 TTTCTAAGGTGAGAAAACTAAGG - Intronic
906847153 1:49205510-49205532 TTTCTAGTGAGACCAACCCAGGG - Intronic
909348217 1:74617069-74617091 TTTTTAATCTGAGCAAAACATGG + Intronic
911656351 1:100448378-100448400 TTTTAAATGTGAACAAACCCAGG + Intronic
912329457 1:108804863-108804885 TTTCTGATGTTAGCAAACAAGGG - Intronic
912585318 1:110758633-110758655 TTTCAAAGGTGACCAAAAGATGG + Intergenic
912712894 1:111962117-111962139 TTTATAATGTGCCTAGACCAGGG - Intronic
918215725 1:182391105-182391127 CTTCCAATGTGACCGAACAATGG - Intronic
921281608 1:213573280-213573302 TTACTAATGTGGCAAAACCCAGG - Intergenic
921711778 1:218380059-218380081 TTTCACATGTGAGGAAACCAAGG + Intronic
923195312 1:231661003-231661025 TTTCATATCTGACCAAACTAAGG - Intronic
1064249083 10:13693184-13693206 TTTCTAACATTTCCAAACCACGG + Intronic
1068752087 10:60606599-60606621 TGTCAAATGTGGCCAAACAAAGG - Intronic
1068856364 10:61801887-61801909 TTTCTAATATTAGCAAAGCAAGG + Intergenic
1068995656 10:63200342-63200364 TTTATAATGTTTCCAAAACATGG + Intronic
1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG + Intergenic
1071146925 10:82586003-82586025 TTTCTAAAGTGACTAAAATAGGG + Intronic
1073614387 10:104978249-104978271 ATTCCAATGTCACCAAATCAAGG - Intronic
1074774593 10:116757687-116757709 TTTTACAGGTGACCAAACCAAGG - Intergenic
1076593732 10:131610636-131610658 TTTCTTATGTAACCACAGCAGGG + Intergenic
1077234935 11:1476908-1476930 TTTCTAATTTAACCCCACCATGG + Intronic
1081285414 11:41263042-41263064 TTTCCTGTGTGACCAAAACATGG - Intronic
1085340469 11:75727965-75727987 TTTCTGATGTGACCAACCCTAGG - Exonic
1085900465 11:80693580-80693602 TCTCTAATGTCACTACACCAAGG + Intergenic
1087144967 11:94801915-94801937 TTTCTAAATTGAACAAGCCAGGG + Intronic
1088511295 11:110578449-110578471 GTTAAAATGTGATCAAACCATGG - Exonic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097687348 12:62703448-62703470 TTTCTAATGAGAAGAAAACAAGG - Intronic
1097973667 12:65662096-65662118 TTTCTAAAGTGACTATAACAAGG + Intergenic
1098287841 12:68926454-68926476 GGTCAAATGTGCCCAAACCATGG + Intronic
1098353857 12:69591235-69591257 TTTCTAATGTAACCAAAAAAAGG + Intronic
1103118255 12:118356598-118356620 TTTTTAATGTGACCAAATTGAGG - Intronic
1106933650 13:34694619-34694641 ATTTTAACGTGAACAAACCAGGG - Intergenic
1107922104 13:45219452-45219474 TTTATAATGTAACGGAACCATGG - Intronic
1108301706 13:49083818-49083840 TTTATAATATCACCCAACCAGGG - Intronic
1113699504 13:112374263-112374285 TTTCTGCTGTGACCAAGCCCAGG + Intergenic
1114596742 14:23918643-23918665 TTTCAAAGGTTACCAAAACATGG - Intergenic
1114645273 14:24252572-24252594 TTCCTCATGTCACCATACCATGG - Intronic
1115775696 14:36712724-36712746 TTTGTAATATGAAAAAACCATGG + Intronic
1116142695 14:41019594-41019616 TTTCTAATGCCATTAAACCAAGG + Intergenic
1118117893 14:62802222-62802244 TTTCCAAAGTTACCAAACAAAGG + Intronic
1118172904 14:63406675-63406697 TTTATAATGTGTGAAAACCAGGG - Intronic
1118437585 14:65785594-65785616 ATTCTAATGTGAACACACCCAGG - Intergenic
1120121278 14:80682444-80682466 TATGTAAAGTGACCAAACCTAGG + Intronic
1120310889 14:82826989-82827011 TTTCTAATGTGATTTAATCACGG + Intergenic
1122047758 14:99035788-99035810 TTTCCAATGTGAGCAAACGGAGG + Intergenic
1122749085 14:103919669-103919691 TTTGTAAGGAGACCATACCAGGG - Intronic
1125064009 15:35459937-35459959 TTTCATATGTGAAAAAACCAAGG + Intronic
1125230929 15:37453932-37453954 TTTAAAATGTGACCATATCAAGG - Intergenic
1129755581 15:78096882-78096904 TTTCTGATGTGAATATACCAAGG - Intronic
1135354506 16:21758042-21758064 TTTCAAATCTGACAAGACCAGGG + Intronic
1135452994 16:22574182-22574204 TTTCAAATCTGACAAGACCAGGG + Intergenic
1137724326 16:50646759-50646781 TTTCTGATTTTCCCAAACCAGGG - Intergenic
1141393536 16:83684484-83684506 TCCCTAATGTAACCAAATCAGGG - Intronic
1143709913 17:8727039-8727061 TTTCACAGGTGACGAAACCAAGG - Intergenic
1144409910 17:14990751-14990773 TTTCCAAAGAGACCATACCATGG - Intergenic
1148588769 17:48799851-48799873 TGTCTAATGTGACAAATCCCTGG + Intronic
1152011010 17:77716846-77716868 TTGCTAATGTGAGCAAGACAAGG - Intergenic
1152351775 17:79787813-79787835 TTTCGAGTGTAACCAAAACAAGG - Exonic
1153100837 18:1467727-1467749 TTTCTAATGTGAACTGACAATGG + Intergenic
1153815467 18:8786503-8786525 TGTCTCATGTGACCATCCCACGG + Intronic
1155701681 18:28751947-28751969 TTTTTAATGCTACAAAACCATGG + Intergenic
1156055288 18:32994903-32994925 TTTCTAAGGTGACTAAATCATGG + Intronic
1159173016 18:64797335-64797357 ATTCTAAAGAGACCAAAGCATGG + Intergenic
1162665690 19:12209855-12209877 TTTCTAATTTGATCAAATTATGG + Intergenic
1162953205 19:14083968-14083990 TTTCTAATGGGTCAAAGCCAGGG - Intronic
1168666947 19:58211377-58211399 GTTCTACTGGGTCCAAACCAGGG - Intronic
926115817 2:10212699-10212721 TTTCTAATATGACCAACTAATGG - Intergenic
927011022 2:18904408-18904430 TCTCTAATGTGCCCCAAACATGG - Intergenic
928879979 2:36087122-36087144 TTTCCAATGTGACCAAGTCATGG + Intergenic
930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG + Intergenic
932083937 2:68740559-68740581 TTTACATTGTGACCAAAGCATGG - Intronic
932274761 2:70443538-70443560 TAGCAAATGGGACCAAACCAGGG - Intergenic
935552543 2:104473627-104473649 TTTGTAATGGGAACTAACCAGGG + Intergenic
939183657 2:138834072-138834094 TCACTAATGTGAACAGACCAGGG + Intergenic
939219198 2:139280599-139280621 TATCAAATGTTACAAAACCAAGG - Intergenic
939864244 2:147455131-147455153 TTTCTAACATCACCAATCCAGGG + Intergenic
941130665 2:161646284-161646306 TCTCTAATGGGATTAAACCAAGG - Intronic
941509599 2:166389305-166389327 TTTGTAGTGTGATTAAACCATGG + Intergenic
941600842 2:167542404-167542426 TTTAAAATGTGGCCAAATCAGGG + Intergenic
941748276 2:169110002-169110024 TTTCCAATATGACCAAACAGGGG - Intergenic
944006341 2:194912456-194912478 TGTCTAATGTCATCAAAACAAGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945321966 2:208434959-208434981 TTTATTATGTGAGCAAAGCAAGG + Intronic
1170498012 20:16945739-16945761 TTTCTCATGTGAACATACCTAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178545387 21:33489284-33489306 TTTCTAATGATACCAAAATATGG + Exonic
1183243487 22:36675614-36675636 TTTCCAATGTCACCCCACCAGGG + Intronic
1184284683 22:43463581-43463603 TTTTTAATTTGACCAAAAGAGGG - Intronic
949825713 3:8163024-8163046 ATTCCAATGTCACCCAACCAGGG - Intergenic
951454529 3:22875282-22875304 TTTCTAATGTGAGAAAACTGAGG - Intergenic
952163393 3:30719161-30719183 CTCCTAATGTGAACAAACAAGGG - Intergenic
952523036 3:34181339-34181361 TGTCTGATTTGCCCAAACCAAGG + Intergenic
954217006 3:49130258-49130280 CTTCTACCGTGACCCAACCAAGG - Exonic
955501082 3:59583604-59583626 TTTGTGTTCTGACCAAACCAGGG + Intergenic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
957429014 3:80077389-80077411 GTTCTCATGTCACTAAACCAGGG + Intergenic
959834050 3:110897332-110897354 TTTCTAATGTGTGAAATCCAGGG - Intergenic
960699741 3:120428276-120428298 TTACTAATGTGCCCAATCCAAGG - Intronic
962029711 3:131586989-131587011 TTATTAATGTCACCAAATCATGG + Intronic
964521601 3:157575263-157575285 TTTCTAAAGTGACCAAAAAATGG - Intronic
965542201 3:169881473-169881495 TTTCTAATATTCCCAAAGCAAGG - Intergenic
967081391 3:186053002-186053024 TTTCAAATGTATGCAAACCAGGG + Intronic
969208972 4:5671846-5671868 TTTCACATGTGAAGAAACCAAGG + Intronic
970940501 4:21627271-21627293 TTTATAATGAAACTAAACCATGG - Intronic
971205187 4:24560151-24560173 ATTCTGATTTGAACAAACCATGG + Intronic
971758960 4:30738990-30739012 TTTATCATGAGACCAATCCATGG + Intronic
976368052 4:84253114-84253136 TTGCTACTGCAACCAAACCAAGG - Intergenic
978048422 4:104164287-104164309 CTGCTAATGTGGCCAAAACAAGG + Intergenic
978332680 4:107631698-107631720 TTTCCAAAGTGATTAAACCAGGG + Exonic
978617939 4:110614421-110614443 TCGCGAATGTGACCAAACAAAGG - Intergenic
978676533 4:111325663-111325685 TTTATCATGGGAGCAAACCAGGG - Intergenic
979454216 4:120908254-120908276 TCTCTAAAGTGACCAAAGCAGGG + Intronic
980204102 4:129695249-129695271 TTTTTAATGTAACCAAAAGAGGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982660504 4:158201051-158201073 TTTATAATATGACCAAACAAGGG + Intergenic
984168455 4:176332255-176332277 TTTCTAATGTGACCAAACCATGG + Intergenic
984271468 4:177552768-177552790 TTTCTCAGGTGAAGAAACCAAGG - Intergenic
984517831 4:180762966-180762988 TTACTAAAGTGACCAGACCAAGG - Intergenic
985828638 5:2212287-2212309 TTTTAAGTGTGACCAACCCAAGG - Intergenic
986968692 5:13305976-13305998 TTTTGAAAGTGACAAAACCAAGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987912986 5:24173272-24173294 TTTCTAATGGTACCAAAATATGG + Intronic
988336653 5:29916375-29916397 TTTCTAATTTGATCATGCCATGG - Intergenic
990032189 5:51275449-51275471 TTTCTACTGCGACCTCACCAAGG + Intergenic
991380197 5:66013850-66013872 TTTCTTAGGTGGCCAAAACAGGG + Intronic
992751607 5:79867672-79867694 TTTCTGATGAGAACAAAGCATGG - Intergenic
996237052 5:121142988-121143010 TGTCTAATGTGATAAAACCTGGG - Intergenic
996345836 5:122487382-122487404 TTTCTAATCAGACCAAACAAAGG - Intergenic
999482634 5:151962867-151962889 TTTCTAATATGACCTGCCCATGG + Intergenic
1000130332 5:158290911-158290933 TTTCTAATATAACCCAACAATGG - Intergenic
1000778595 5:165450520-165450542 TGTCTGATGTGACAAAAACAAGG - Intergenic
1000889487 5:166786110-166786132 TTTCTCATGGGACCGAGCCAGGG - Intergenic
1001744917 5:174085011-174085033 TTTCTGCTCTGATCAAACCATGG + Intronic
1001899494 5:175413530-175413552 TTTCTAATCAGCCCAAACCTCGG + Intergenic
1002604578 5:180374998-180375020 TTTCCAGTAGGACCAAACCAAGG - Intergenic
1005141689 6:22639170-22639192 TTTATAATGTCACCATATCATGG + Intergenic
1006145559 6:31957187-31957209 TTCCTAATCTAACCAAACCACGG + Intronic
1009918059 6:70021044-70021066 TTTATTATGTGCTCAAACCAGGG - Intronic
1010911009 6:81556438-81556460 GTTCTAATGTGACCATACCCTGG + Intronic
1011498408 6:87961608-87961630 TTTCTCCTGTGACCAAGCCTAGG + Intergenic
1011887240 6:92111312-92111334 TTTCTAAGTTGGCCAAATCATGG - Intergenic
1012243626 6:96901526-96901548 TTACAAATGTGACTAAATCAAGG - Intergenic
1013435803 6:110105193-110105215 TTTCTAAGATGACAAAACTAAGG + Intronic
1015803252 6:137081926-137081948 TTTCACATGTGAGAAAACCAAGG - Intergenic
1016511875 6:144851550-144851572 TTATTAATGTGGCCAAATCACGG - Exonic
1019208017 6:170378821-170378843 TTTTTAATGTGGCCAAATAAAGG - Intronic
1021582838 7:22175260-22175282 TCTCTAAGGTCATCAAACCAGGG - Intronic
1025747086 7:64252260-64252282 TTTTCAAGGTGACCAACCCAGGG - Intronic
1026427889 7:70314837-70314859 TGACTGATGTGACAAAACCATGG - Intronic
1028391584 7:90322472-90322494 TTTCCAATGTGACTTAACCTTGG + Intergenic
1029886701 7:103880413-103880435 TTTCAAATGTGAGAAAACTAAGG + Intronic
1030364868 7:108634114-108634136 TTTTTAAGGTGAGGAAACCAAGG + Intergenic
1031426382 7:121610487-121610509 TTTCTATTCTGATCAAACCTGGG - Intergenic
1032368523 7:131323688-131323710 TTTCAAAAGTGACCAAAGCCAGG + Intronic
1032458089 7:132088559-132088581 TTTCTCATGTGCCCCAACCCCGG + Intergenic
1032656929 7:133940675-133940697 TTTATAATTTGAACAAAGCAGGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036987050 8:13545203-13545225 TTTTTAATATGAACAAAACATGG + Intergenic
1038597296 8:28899745-28899767 TTTATTATATTACCAAACCAGGG + Intronic
1041929134 8:63267994-63268016 TGGATAATGTGACCAAATCATGG + Intergenic
1041936471 8:63337638-63337660 TTTCTGAAGTGAGGAAACCAAGG - Intergenic
1043924117 8:86017483-86017505 TTTCGAATGAGAACAAACTATGG - Intronic
1047575606 8:126150819-126150841 TATGTAAAGTGACCAAACCTTGG + Intergenic
1048816512 8:138339530-138339552 TTTCTGATGTCACGAAAGCATGG - Intronic
1051494731 9:17707202-17707224 TCTCTAATGAGACCACAACAAGG - Intronic
1053226019 9:36358274-36358296 TTTTGAATGTGACCAAATAATGG - Intronic
1055737713 9:79349951-79349973 TGTCTCATGTGACAAAAGCATGG + Intergenic
1058256281 9:102768378-102768400 TTTCTAACATGACGAAACAATGG - Intergenic
1060338131 9:122746130-122746152 TTTGTTATGTGACAAAAACAAGG - Intergenic
1186249912 X:7654736-7654758 TTTCTAATTTTACCAACTCAGGG + Intergenic
1188679640 X:32986381-32986403 TTTCTAAAGTCACCAAAAAAAGG - Intronic
1191192568 X:57682183-57682205 TTTCAAAAGTGGCCAAACCCAGG + Intergenic
1193897009 X:87127085-87127107 TTTCTATTGTTACCATACCTGGG - Intergenic
1199451089 X:147979960-147979982 TTGCTGGTGTGCCCAAACCAAGG + Intergenic
1201855056 Y:18532115-18532137 TTTGTACTGTGAACAAACTAAGG - Intergenic
1201878265 Y:18788269-18788291 TTTGTACTGTGAACAAACTAAGG + Intronic
1202112863 Y:21442719-21442741 TTTCTCCTGTTGCCAAACCATGG + Intergenic