ID: 984169111

View in Genome Browser
Species Human (GRCh38)
Location 4:176340095-176340117
Sequence GACAGAGCAGTGACCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984169110_984169111 3 Left 984169110 4:176340069-176340091 CCTATTTGCTAGGCATTGTTCTA No data
Right 984169111 4:176340095-176340117 GACAGAGCAGTGACCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984169111 Original CRISPR GACAGAGCAGTGACCAAAGC AGG Intergenic
No off target data available for this crispr