ID: 984171157

View in Genome Browser
Species Human (GRCh38)
Location 4:176360918-176360940
Sequence CTGCTGTACTTTAGGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984171157_984171162 29 Left 984171157 4:176360918-176360940 CCCTTTCTCCTAAAGTACAGCAG No data
Right 984171162 4:176360970-176360992 ACACTGGACAATATTATATATGG No data
984171157_984171160 13 Left 984171157 4:176360918-176360940 CCCTTTCTCCTAAAGTACAGCAG No data
Right 984171160 4:176360954-176360976 AAATGAAAAACACCAAACACTGG No data
984171157_984171163 30 Left 984171157 4:176360918-176360940 CCCTTTCTCCTAAAGTACAGCAG No data
Right 984171163 4:176360971-176360993 CACTGGACAATATTATATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984171157 Original CRISPR CTGCTGTACTTTAGGAGAAA GGG (reversed) Intergenic
No off target data available for this crispr