ID: 984172059

View in Genome Browser
Species Human (GRCh38)
Location 4:176370867-176370889
Sequence AGAACTACCCTGCAAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984172054_984172059 3 Left 984172054 4:176370841-176370863 CCCAGAATTAACTAGAAGAGAAT No data
Right 984172059 4:176370867-176370889 AGAACTACCCTGCAAAAAGGGGG No data
984172052_984172059 29 Left 984172052 4:176370815-176370837 CCTTCACTAACTTGACTTTACCA No data
Right 984172059 4:176370867-176370889 AGAACTACCCTGCAAAAAGGGGG No data
984172055_984172059 2 Left 984172055 4:176370842-176370864 CCAGAATTAACTAGAAGAGAATT No data
Right 984172059 4:176370867-176370889 AGAACTACCCTGCAAAAAGGGGG No data
984172053_984172059 9 Left 984172053 4:176370835-176370857 CCATTGCCCAGAATTAACTAGAA No data
Right 984172059 4:176370867-176370889 AGAACTACCCTGCAAAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984172059 Original CRISPR AGAACTACCCTGCAAAAAGG GGG Intergenic
No off target data available for this crispr