ID: 984172463

View in Genome Browser
Species Human (GRCh38)
Location 4:176376940-176376962
Sequence AAACTGTTCTAGAGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984172461_984172463 22 Left 984172461 4:176376895-176376917 CCATCATTGTACTAATGAAGAAA 0: 2
1: 2
2: 32
3: 201
4: 1138
Right 984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG No data
984172460_984172463 28 Left 984172460 4:176376889-176376911 CCATCTCCATCATTGTACTAATG No data
Right 984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984172463 Original CRISPR AAACTGTTCTAGAGAAAAAA AGG Intergenic
No off target data available for this crispr