ID: 984176443

View in Genome Browser
Species Human (GRCh38)
Location 4:176424363-176424385
Sequence AGTTATCTCAAAGAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984176443_984176446 -10 Left 984176443 4:176424363-176424385 CCTGCCATCTCTTTGAGATAACT No data
Right 984176446 4:176424376-176424398 TGAGATAACTTTTTAAAGGAAGG No data
984176443_984176447 -9 Left 984176443 4:176424363-176424385 CCTGCCATCTCTTTGAGATAACT No data
Right 984176447 4:176424377-176424399 GAGATAACTTTTTAAAGGAAGGG No data
984176443_984176448 -8 Left 984176443 4:176424363-176424385 CCTGCCATCTCTTTGAGATAACT No data
Right 984176448 4:176424378-176424400 AGATAACTTTTTAAAGGAAGGGG No data
984176443_984176449 -7 Left 984176443 4:176424363-176424385 CCTGCCATCTCTTTGAGATAACT No data
Right 984176449 4:176424379-176424401 GATAACTTTTTAAAGGAAGGGGG No data
984176443_984176450 8 Left 984176443 4:176424363-176424385 CCTGCCATCTCTTTGAGATAACT No data
Right 984176450 4:176424394-176424416 GAAGGGGGACAAAATCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984176443 Original CRISPR AGTTATCTCAAAGAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr