ID: 984176949

View in Genome Browser
Species Human (GRCh38)
Location 4:176430706-176430728
Sequence TCTCCATGGCTGTTACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984176944_984176949 -9 Left 984176944 4:176430692-176430714 CCCCTACCAGCTTGTCTCCATGG No data
Right 984176949 4:176430706-176430728 TCTCCATGGCTGTTACAGACAGG No data
984176946_984176949 -10 Left 984176946 4:176430693-176430715 CCCTACCAGCTTGTCTCCATGGC No data
Right 984176949 4:176430706-176430728 TCTCCATGGCTGTTACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984176949 Original CRISPR TCTCCATGGCTGTTACAGAC AGG Intergenic
No off target data available for this crispr