ID: 984180029

View in Genome Browser
Species Human (GRCh38)
Location 4:176470821-176470843
Sequence TGTGGGCCAACTTTATAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984180026_984180029 3 Left 984180026 4:176470795-176470817 CCTTCACATTTTTTTTTTAAACA No data
Right 984180029 4:176470821-176470843 TGTGGGCCAACTTTATAGCACGG No data
984180025_984180029 26 Left 984180025 4:176470772-176470794 CCAATTTTTAAGTGCTAGTAAAT No data
Right 984180029 4:176470821-176470843 TGTGGGCCAACTTTATAGCACGG No data
984180024_984180029 27 Left 984180024 4:176470771-176470793 CCCAATTTTTAAGTGCTAGTAAA No data
Right 984180029 4:176470821-176470843 TGTGGGCCAACTTTATAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984180029 Original CRISPR TGTGGGCCAACTTTATAGCA CGG Intergenic
No off target data available for this crispr