ID: 984181767

View in Genome Browser
Species Human (GRCh38)
Location 4:176491722-176491744
Sequence CCAGGCTGCCTTTCAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984181764_984181767 6 Left 984181764 4:176491693-176491715 CCACATAAATTGATGTTCTCTCA No data
Right 984181767 4:176491722-176491744 CCAGGCTGCCTTTCAAAAACTGG No data
984181763_984181767 25 Left 984181763 4:176491674-176491696 CCAGGATTCAGGGCTTCTGCCAC No data
Right 984181767 4:176491722-176491744 CCAGGCTGCCTTTCAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984181767 Original CRISPR CCAGGCTGCCTTTCAAAAAC TGG Intergenic
No off target data available for this crispr