ID: 984188773

View in Genome Browser
Species Human (GRCh38)
Location 4:176579367-176579389
Sequence GGTGTAAACAGACCAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984188773_984188775 13 Left 984188773 4:176579367-176579389 CCTGCTGTTGGTCTGTTTACACC No data
Right 984188775 4:176579403-176579425 ATTTTTATCTGTTTACGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984188773 Original CRISPR GGTGTAAACAGACCAACAGC AGG (reversed) Intergenic
No off target data available for this crispr