ID: 984192672

View in Genome Browser
Species Human (GRCh38)
Location 4:176624446-176624468
Sequence GCTCGTGGTCTCGCTGGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984192667_984192672 -8 Left 984192667 4:176624431-176624453 CCTTCCTCCGGATGGGCTCGTGG No data
Right 984192672 4:176624446-176624468 GCTCGTGGTCTCGCTGGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984192672 Original CRISPR GCTCGTGGTCTCGCTGGCTT CGG Intergenic
No off target data available for this crispr