ID: 984196071

View in Genome Browser
Species Human (GRCh38)
Location 4:176659708-176659730
Sequence TGTTATTGGAAGCTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984196071_984196075 22 Left 984196071 4:176659708-176659730 CCTTCCTCTAGCTTCCAATAACA No data
Right 984196075 4:176659753-176659775 TTTCACTGACTCCCTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984196071 Original CRISPR TGTTATTGGAAGCTAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr