ID: 984197063

View in Genome Browser
Species Human (GRCh38)
Location 4:176670923-176670945
Sequence AGAGATCACCAGGGGAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984197059_984197063 -1 Left 984197059 4:176670901-176670923 CCACAGTGTGACAGTTGGCTAGA No data
Right 984197063 4:176670923-176670945 AGAGATCACCAGGGGAAGTTAGG No data
984197058_984197063 0 Left 984197058 4:176670900-176670922 CCCACAGTGTGACAGTTGGCTAG No data
Right 984197063 4:176670923-176670945 AGAGATCACCAGGGGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984197063 Original CRISPR AGAGATCACCAGGGGAAGTT AGG Intergenic
No off target data available for this crispr