ID: 984203197

View in Genome Browser
Species Human (GRCh38)
Location 4:176753130-176753152
Sequence CATTCTTAAGGGCTGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984203191_984203197 13 Left 984203191 4:176753094-176753116 CCTGCTGAAACAGTCAGTGACAG 0: 1
1: 0
2: 1
3: 12
4: 133
Right 984203197 4:176753130-176753152 CATTCTTAAGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 15
4: 141
984203190_984203197 19 Left 984203190 4:176753088-176753110 CCTGATCCTGCTGAAACAGTCAG 0: 1
1: 0
2: 0
3: 14
4: 139
Right 984203197 4:176753130-176753152 CATTCTTAAGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 15
4: 141
984203188_984203197 30 Left 984203188 4:176753077-176753099 CCTACCTCTAGCCTGATCCTGCT 0: 1
1: 0
2: 2
3: 28
4: 254
Right 984203197 4:176753130-176753152 CATTCTTAAGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 15
4: 141
984203189_984203197 26 Left 984203189 4:176753081-176753103 CCTCTAGCCTGATCCTGCTGAAA 0: 1
1: 0
2: 3
3: 8
4: 153
Right 984203197 4:176753130-176753152 CATTCTTAAGGGCTGGTGAATGG 0: 1
1: 0
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984203197 Original CRISPR CATTCTTAAGGGCTGGTGAA TGG Intronic
903874629 1:26464995-26465017 CAGTCTTAAAGGCTGGCAAAGGG + Intronic
905246634 1:36619398-36619420 CTATCTTAAGGGCTGCTGAGGGG + Intergenic
907923154 1:58931682-58931704 CATTTAGAAGGGCTAGTGAAGGG - Intergenic
916167521 1:161977211-161977233 GATTTCTAAGGGCTGGGGAAGGG + Intergenic
916500863 1:165385689-165385711 CATGGTCCAGGGCTGGTGAATGG - Intergenic
916748807 1:167705425-167705447 CATTCTCAAGGGTGGGAGAAGGG - Exonic
916864924 1:168846183-168846205 CATTCATCAGTGCTTGTGAATGG + Intergenic
917274561 1:173318477-173318499 CATTCTTAAGGTCAAGGGAATGG + Intergenic
917307104 1:173638257-173638279 CATCCTTAAAGGCTTGTGAAAGG - Intronic
917772170 1:178291720-178291742 AATTCTTAAGTGTGGGTGAAAGG - Intronic
918435276 1:184504622-184504644 CATTCTCAAAGGCTGGTGCCGGG - Intronic
921005065 1:211085218-211085240 CATTCTGAATGGCTGGATAAAGG + Intronic
921405161 1:214770980-214771002 CATTCTTAATGCATGTTGAATGG + Intergenic
924706739 1:246508426-246508448 CATTATTAAGGGCAGCTGGATGG + Intergenic
924817868 1:247458444-247458466 AACTCTTTAGGGCTGGTGCATGG + Intergenic
924817883 1:247458603-247458625 AACTCTTTAGGGCTGGTGCATGG + Intergenic
1063574762 10:7251842-7251864 CATTCCTGAGGTCTGGTGCACGG + Intronic
1065828397 10:29592873-29592895 CATTCTTTAGGGCTAGCAAAAGG + Intronic
1066178077 10:32930746-32930768 AGTTCTTAATGGCAGGTGAATGG + Intronic
1070719901 10:78749123-78749145 CATTTTTTAGGGCTGGAGCACGG + Intergenic
1071836885 10:89427076-89427098 CATTTTTAAGAGATGGTGAAAGG - Intergenic
1073972933 10:109065014-109065036 CTATTTTAAGGTCTGGTGAAGGG + Intergenic
1074391688 10:113063431-113063453 CATTTTACAGTGCTGGTGAATGG + Intronic
1075258735 10:120945099-120945121 GATTCAGAAGGGCTGGTGCAGGG - Intergenic
1077267325 11:1657807-1657829 GTTTCTTCAGGGCTGGTGAGGGG - Intergenic
1078117140 11:8464858-8464880 CATTTTTAATAGCTGATGAATGG - Intronic
1080176351 11:29367416-29367438 TATCCTTAGGGGCTGGTGAGGGG + Intergenic
1081703096 11:45164201-45164223 CATCCTTTAGGTCTGGTGAGTGG + Intronic
1084754041 11:71223290-71223312 CATTCTCATGGGGTGGTGGAAGG + Intronic
1085067385 11:73509716-73509738 CATTGTTAAGTGCTGGAGAGTGG - Intronic
1086637888 11:89113129-89113151 CATTCTTAAGGACGGGCCAAAGG + Intergenic
1086821409 11:91440914-91440936 CACTCTTAATGACTGGAGAAGGG + Intergenic
1089189319 11:116642760-116642782 CATTCCTAGGGGCTGGAGGATGG + Intergenic
1093552105 12:20425588-20425610 CACTTTTCAGGGCTGTTGAAAGG - Intronic
1094637515 12:32240728-32240750 CATTTTTAAGGGGTGGGGAGTGG - Intronic
1102440549 12:112960982-112961004 TATTCATAAAGGCTGGTGAATGG + Intronic
1104710603 12:130983003-130983025 CATTCTTAAGGGAGGCTGCATGG + Intronic
1106342858 13:28847767-28847789 CAGTCTTCAGGGCTGCTGCATGG - Intronic
1109144712 13:58764851-58764873 CATTTTGGAGGGATGGTGAAAGG - Intergenic
1110472219 13:75873228-75873250 CATTTTTAAGACCTGGAGAAGGG - Intronic
1112054837 13:95680847-95680869 CGTTCTGAAGAGCAGGTGAATGG - Intronic
1112867799 13:103928134-103928156 CATTCTTTTGGACTGGTGACTGG - Intergenic
1118314517 14:64717414-64717436 CATTCTGATGGGCTTGGGAAGGG + Intronic
1119960205 14:78847398-78847420 CTCTCTTAAGTGCTGGGGAAAGG - Intronic
1122588646 14:102829227-102829249 CATTCTGAAAAGCTTGTGAATGG + Intronic
1122647650 14:103206058-103206080 CAGGCTCAAGGGCAGGTGAAGGG - Intergenic
1123776735 15:23588064-23588086 CATTCTTGATGGCTGCTGAGGGG + Intronic
1123817883 15:23998148-23998170 CATTCTTGACGGCTGCTGAGGGG + Intergenic
1123950895 15:25273801-25273823 CATTCTTGAGTTCTGCTGAATGG + Intergenic
1125710295 15:41779788-41779810 CATTCACAAAGGCTGGTGAGGGG - Intronic
1128609271 15:69060885-69060907 CATTGTTAACATCTGGTGAAAGG + Intronic
1130182318 15:81643138-81643160 CATTTTTATGGGATTGTGAAAGG - Intergenic
1130862921 15:87907495-87907517 CAGTCTTATGGGCAGGTGCATGG - Intronic
1134296049 16:12946768-12946790 CATTCTCAACAGCTGGTGAAGGG + Intronic
1136512994 16:30750536-30750558 CATCCTGAAGGGATGTTGAAGGG - Intronic
1137980632 16:53066402-53066424 CATTTTTTAAGGCTGGTAAAAGG - Intronic
1139330068 16:66181431-66181453 CATTCTTAATTGCTGCTGCAAGG - Intergenic
1144016880 17:11204579-11204601 CATTCTTCAGGTCTTGTTAAAGG - Intergenic
1145924680 17:28637494-28637516 ATTTCTTAAGGGCTTATGAAAGG - Intronic
1147479037 17:40741492-40741514 CTTTTTTAAAGGCAGGTGAAAGG - Intergenic
1151278591 17:73055067-73055089 CATTGTTGACAGCTGGTGAAGGG - Intronic
1151458009 17:74238137-74238159 CATTCTTCGTGGCTGGTGCAGGG + Intronic
1151836944 17:76587998-76588020 CAGTCTTAAGAGCTGGGGAGAGG + Intergenic
1159214301 18:65370437-65370459 CATTCTTAAGTTCTGGTAAAAGG + Intergenic
1159851862 18:73534623-73534645 ATTCCGTAAGGGCTGGTGAAGGG + Intergenic
926319084 2:11735823-11735845 CATTCTTTAGAGCTGATAAATGG + Intronic
931379418 2:61738481-61738503 AATTCTCAAGGGCTGTTGAGGGG + Intergenic
931747273 2:65301161-65301183 CAAACTTAAAAGCTGGTGAATGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932743441 2:74310334-74310356 TATTGAAAAGGGCTGGTGAAAGG + Intronic
934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG + Intergenic
934202060 2:89894279-89894301 CTTTCTGAAGGGCAGGTGAAGGG - Intergenic
937903162 2:127038100-127038122 CCATCTTCAGGCCTGGTGAAAGG + Intergenic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
939533439 2:143393940-143393962 CATTCTTATGAGCTGGAGGATGG + Intronic
944656992 2:201885460-201885482 GCTTCTTAAGGGCTGATTAATGG - Intronic
946589222 2:221224969-221224991 CATTCTTAAGGCCTGCTCAGTGG - Intergenic
947517152 2:230815737-230815759 CATTCCTAAGGGCTTGGAAATGG - Intronic
1169488273 20:6051732-6051754 CATGCTTTGGGGCTGATGAATGG - Intronic
1169939811 20:10924804-10924826 CATTCTTAAGAGCTGAGGAAAGG - Intergenic
1171120719 20:22567169-22567191 CAGACTTTAGGTCTGGTGAAGGG + Intergenic
1171323684 20:24270788-24270810 GAGTCTTCAGGGCTGGTGAAGGG + Intergenic
1175049450 20:56140841-56140863 TATTCACAAGGGATGGTGAAAGG - Intergenic
1175141432 20:56863197-56863219 CATTCTTCAGGTCTGTTGGAAGG - Intergenic
1179825882 21:43966303-43966325 CATGCCTAAAGGCTGGAGAAGGG - Intronic
1182664495 22:31947185-31947207 CTTTCTTCAGGGCTGGGGAAGGG + Intronic
950046968 3:9954342-9954364 CATCCCTAATGGCTGGTAAATGG + Intergenic
950907710 3:16554071-16554093 GTTTCTTCAGGGCTGATGAATGG + Intergenic
954643809 3:52118357-52118379 CATTCTGAATGGCTGGGAAATGG + Intronic
954962117 3:54575872-54575894 CCTTCTTAGGGGCTGGGGTAGGG - Intronic
956229441 3:66997977-66997999 CATTCTGAGGGGCTGGGGTAGGG - Intergenic
957540530 3:81563592-81563614 CACCTTTAAGGGCTGGTGCAGGG - Intronic
964663149 3:159143089-159143111 CTTTCTTAAGAGCTGATGTACGG - Intronic
966877424 3:184331087-184331109 CATTCCTACGGTCTGGTGCAGGG - Intronic
970628836 4:17919780-17919802 CCTACTTCAGGGCAGGTGAAAGG - Intronic
973224219 4:47764740-47764762 AATTCTTAATGGCTCATGAAAGG + Intronic
974836642 4:67259374-67259396 AAATCTTTAAGGCTGGTGAATGG - Intergenic
976658716 4:87516848-87516870 CATGATTAAGAGATGGTGAAAGG - Intronic
979053954 4:115973073-115973095 AAGTCTTACTGGCTGGTGAAAGG - Intergenic
979810950 4:125035393-125035415 AAATCTTGAGAGCTGGTGAAGGG + Intergenic
980796605 4:137692240-137692262 CATTTTCAAGGCCTGGTGTATGG - Intergenic
981608248 4:146563514-146563536 CTTTCTTAAGGGCAGAAGAATGG + Intergenic
984203197 4:176753130-176753152 CATTCTTAAGGGCTGGTGAATGG + Intronic
985977034 5:3428210-3428232 TATTAATAAGGGCCGGTGAAAGG - Intergenic
987650114 5:20730442-20730464 CATTCTTAAGGCCTAGGGCAAGG + Intergenic
988698113 5:33644625-33644647 AGTTCTTAAGGGCTTGTTAAGGG + Intronic
988745444 5:34131024-34131046 CATTCTTAAGGCCTAGGGCAAGG - Intergenic
989516496 5:42349274-42349296 CATTCTTATGGGCTGGTAGCAGG + Intergenic
991231571 5:64338709-64338731 CATTCTTAAAACCTGATGAAGGG - Intronic
991610915 5:68448899-68448921 CATTCTTAGGGCTTGGAGAAAGG - Intergenic
993141450 5:84038967-84038989 CATTCCAGAGGGCTGTTGAAAGG - Intronic
993834593 5:92802262-92802284 CTATCTGAAGGGCTGGTGCAAGG + Intergenic
998457853 5:142287588-142287610 TAGCCTTAAGGGCTGGTGAAAGG - Intergenic
999031319 5:148295803-148295825 AATTCTCAAGGGCTGATGTAAGG + Intergenic
1000077810 5:157810064-157810086 AATTCTTAAAGGCTACTGAAAGG + Intronic
1000754316 5:165137785-165137807 CATTCTCAAGTTCTGGTGATTGG + Intergenic
1001122262 5:168990564-168990586 CATTCTAAAGGGAGAGTGAAGGG + Intronic
1002762972 6:216076-216098 CATTCTTAACAGCTGGACAATGG + Intergenic
1004601758 6:17157142-17157164 CGTTCTGGAGGGCAGGTGAAGGG - Intergenic
1004893047 6:20120255-20120277 CATTTTAAAGGGCTGTTGAAAGG + Intronic
1005490922 6:26346285-26346307 CATTCTTGAGGGGTGCTGAAGGG - Intergenic
1009502348 6:64430813-64430835 CATGGTGAAGGACTGGTGAAAGG - Intronic
1013163634 6:107569986-107570008 CATTGTGAAGGGCAGGTGTAGGG + Intronic
1015568003 6:134593867-134593889 CATTTTTATGAGTTGGTGAAGGG - Intergenic
1015645947 6:135388651-135388673 CAATTTTAAGAGCTGGTCAAGGG + Intronic
1022629592 7:32072080-32072102 CTTTGTTAAGGTCAGGTGAATGG - Intronic
1023335655 7:39166593-39166615 CTTTCCTAAGGGCTAGTGACAGG - Intronic
1024999588 7:55303888-55303910 CCTTCTTAAGGGCATCTGAAGGG + Intergenic
1026041711 7:66873770-66873792 CATTATTCAGGGCTGGTAAAGGG - Intergenic
1027355082 7:77346889-77346911 CATGCCTTAGGGCAGGTGAAAGG - Intronic
1028941304 7:96525295-96525317 AATTCTTTAGGTCTGGTGCAGGG - Intronic
1031524285 7:122805700-122805722 GAATGTCAAGGGCTGGTGAAAGG + Intronic
1036186968 8:6630884-6630906 CCTTTTTAGTGGCTGGTGAAAGG - Intronic
1036997173 8:13671391-13671413 CATTCTTTAGGGCCTGGGAATGG + Intergenic
1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG + Intronic
1043538620 8:81233719-81233741 CAATGTTTAGTGCTGGTGAAGGG + Intergenic
1045554463 8:103202212-103202234 CATTCTGAGGCGCTGGGGAAAGG - Intronic
1047282656 8:123459456-123459478 CATTCTTTAGAGATGGGGAAGGG - Intronic
1048408476 8:134147111-134147133 TATTATTAAGGGCTGGAAAACGG - Intergenic
1051323836 9:15942440-15942462 CTTTCTTAAGGGAAGGAGAAAGG + Intronic
1058997909 9:110317862-110317884 CATTTCTAGGGGGTGGTGAAGGG - Intronic
1059748414 9:117225337-117225359 CACTCTGAAGGACGGGTGAATGG + Intronic
1059968470 9:119639727-119639749 CATTATTAAACGCTGGGGAAGGG - Intergenic
1060034194 9:120241121-120241143 CTTTTTTAAAGCCTGGTGAAGGG + Intergenic
1061033997 9:128103401-128103423 CATTGGAAAGGGCCGGTGAATGG + Intronic
1185972068 X:4676258-4676280 TATTCCAAAGGGCTGGAGAAAGG - Intergenic
1187036836 X:15549454-15549476 CATTCATAAGGGTTGGGGCAGGG + Intronic
1187930716 X:24291408-24291430 GATTATTAAGGGCTGGGGGATGG - Intergenic
1188976107 X:36677212-36677234 CATTTTTAAGTGCTTGTAAATGG + Intergenic
1192584509 X:72308605-72308627 CAGCCTTGAGGGCTGGAGAATGG - Intergenic
1196637314 X:118017659-118017681 GTTTCTTAAGTGCTGTTGAAAGG - Intronic
1197008088 X:121527920-121527942 CATTCTTAGGTGTTGGTAAAAGG - Intergenic
1197129496 X:122988669-122988691 CATTTCTATGGGCTGGTGAAAGG + Intergenic
1198986672 X:142462705-142462727 CAATCATAGGGGCAGGTGAAGGG - Intergenic
1199777867 X:151031458-151031480 CACTGTTCAGGGCTGGTGCATGG + Intergenic
1202373682 Y:24214663-24214685 CAATCATTAGGGCTGGTGGAGGG + Intergenic
1202497099 Y:25455457-25455479 CAATCATTAGGGCTGGTGGAGGG - Intergenic