ID: 984205497

View in Genome Browser
Species Human (GRCh38)
Location 4:176783017-176783039
Sequence TGTGCTGAAGACTACAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984205497_984205501 8 Left 984205497 4:176783017-176783039 CCAGCACTGTAGTCTTCAGCACA 0: 1
1: 0
2: 1
3: 5
4: 140
Right 984205501 4:176783048-176783070 ACGCAAGTCACAGCACTGACTGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984205497 Original CRISPR TGTGCTGAAGACTACAGTGC TGG (reversed) Intronic
900747258 1:4369140-4369162 TGTGATGAAGATTATAGTGATGG + Intergenic
900747294 1:4369434-4369456 TGTGATGAAGATTATAGTGATGG + Intergenic
902517489 1:16997140-16997162 AGTGCTGAAGACGGCACTGCCGG - Exonic
904006348 1:27365245-27365267 TGTGCTGAAGACCAAAGGGAGGG - Intronic
906399766 1:45496315-45496337 TGTGCTGAAGAGGACAGTCATGG - Exonic
909250491 1:73347643-73347665 TGTACTGAAGGGTACAATGCAGG + Intergenic
911405759 1:97436681-97436703 TTTGCTGAAGATTAAAATGCTGG - Intronic
916212773 1:162372304-162372326 TGTGCTGCTCAGTACAGTGCTGG + Intronic
918268757 1:182874188-182874210 ACTTCTGAAGACTACAGTGTGGG + Intronic
920350393 1:205334311-205334333 TGAGATGAAGAGTTCAGTGCAGG - Intergenic
922791526 1:228313827-228313849 TGCGCGGAAGATGACAGTGCCGG - Intronic
1063242969 10:4190553-4190575 TGTGCTCAAGATTACACAGCAGG + Intergenic
1063380775 10:5584180-5584202 TGTGCTGCAGGCGACAGAGCTGG + Intergenic
1065133350 10:22644241-22644263 TTTGCTGAAGACTTGACTGCAGG - Intronic
1067839174 10:49662562-49662584 AGTCCTGTAGACTACAGAGCAGG + Intronic
1071061149 10:81571418-81571440 TGCCCTGAGGACTACAGTGATGG - Intergenic
1072565659 10:96614819-96614841 TGTGCAGAACAGTACAGTGATGG - Intronic
1072614357 10:97039624-97039646 TGTGAAGAACACTACACTGCTGG + Intronic
1075723407 10:124599954-124599976 GGTCCTGAAGACCACAGGGCAGG + Intronic
1077364021 11:2154325-2154347 CGTGCTCAAGGCTGCAGTGCTGG + Intronic
1079429626 11:20376609-20376631 TGTGCTGAAGTCTGCAGAGCTGG + Exonic
1079723528 11:23849209-23849231 TGTGGAGAAGACTATAGAGCAGG + Intergenic
1080977872 11:37364209-37364231 TGTGCTGCAGCCAAGAGTGCAGG + Intergenic
1081864659 11:46352846-46352868 TGTGCTGAAACCCACACTGCAGG - Intronic
1089200371 11:116721036-116721058 TGTGCTGAGGACCACAGTCGGGG - Intergenic
1090198502 11:124837851-124837873 GGAGCTGAAGTCTTCAGTGCTGG - Intergenic
1090224241 11:125059847-125059869 TGTACTGAAGACTAGATTGATGG - Intergenic
1097736960 12:63193036-63193058 TGTGCTGGGGACTACAGGTCAGG - Intergenic
1098779757 12:74671910-74671932 GGGGCTCAAGACTACAGTGGTGG + Intergenic
1099839991 12:87953444-87953466 TGTGCTGAACACTAGAGGGCAGG - Intergenic
1100460037 12:94790437-94790459 AGGGCTGAAGGCCACAGTGCTGG - Intergenic
1103448793 12:121013228-121013250 TGTGCTGAAGACGAAAGACCAGG - Intronic
1112997978 13:105597692-105597714 TCAGCTGAGGACTCCAGTGCAGG - Intergenic
1113463693 13:110498964-110498986 TGAGCTGATGACTTCAGAGCAGG + Intronic
1115468496 14:33743021-33743043 GGTGCTCAAGACTTCAGTGGAGG - Intronic
1119815430 14:77562368-77562390 TTTGCTGAAGAATTCACTGCTGG - Intronic
1121265563 14:92600190-92600212 TGAGCTGAAGGATGCAGTGCAGG + Intronic
1122860081 14:104578618-104578640 TGTACTGAAGACGGCAGTGAGGG + Intronic
1122985578 14:105210135-105210157 TGGGCTGGAGACTCCAGAGCTGG + Exonic
1124214261 15:27793605-27793627 AGGGCTGAAGGCTACGGTGCCGG - Intronic
1125132091 15:36294603-36294625 TGTGGTGAGGATCACAGTGCTGG + Intergenic
1126033600 15:44525131-44525153 TGTGCTGAATACTTCATTCCTGG - Exonic
1128411943 15:67408242-67408264 TTTGCTGAAAACCACAGAGCAGG + Intronic
1128651016 15:69413795-69413817 TGAGCTGAAGACTGCAGTCCAGG + Intergenic
1128690571 15:69721692-69721714 AGTGCTGAAGACTCCGGTACAGG + Intergenic
1130742432 15:86615309-86615331 TGTGGTAAAGACTAGAGTGGAGG + Intronic
1134680456 16:16121474-16121496 TATGCTGAAAACCACACTGCTGG + Intronic
1135117386 16:19735204-19735226 TTTGCTCCAGACTACAGAGCTGG - Intronic
1135238049 16:20776907-20776929 TGTGGTGAAGTGTACAGTTCTGG + Intronic
1140722980 16:77788078-77788100 TGCCCTGAAGAGTCCAGTGCAGG - Intergenic
1140955519 16:79861453-79861475 TGTGCTGAAGACTGGACTGGTGG - Intergenic
1141141412 16:81499107-81499129 TGTGCTCAAGGCTTCAGTCCAGG + Intronic
1141743357 16:85909214-85909236 TGTGGTGAAGGCTACAGGCCAGG - Intronic
1144371179 17:14593250-14593272 TGTGCTGAAGGATTAAGTGCAGG + Intergenic
1145847155 17:28050291-28050313 TATGCAGGAGACTACAGGGCTGG + Intronic
1148034987 17:44653471-44653493 TGTGCTGCAGGCTGGAGTGCAGG - Intergenic
1148654731 17:49274778-49274800 TGTCCTGAAGACGGCAGTGAGGG - Intergenic
1151860910 17:76760903-76760925 TATGCATAAGACTACATTGCTGG + Intronic
1152228915 17:79105087-79105109 TGTCCTGAAGCCTGCAGTGCAGG + Intronic
1153734546 18:8051412-8051434 TGAGCAGAAGACTACAGTTAGGG - Intronic
1158833600 18:61306605-61306627 TGTGCTTAAGGCCACAATGCTGG - Intergenic
1160398877 18:78594294-78594316 TGTTCTGGAGATTACAGTCCTGG + Intergenic
1161053121 19:2175907-2175929 TGTGCGGAAGAGCCCAGTGCTGG - Intronic
1161321056 19:3641757-3641779 TCTGCAGCAGATTACAGTGCAGG - Exonic
1163060634 19:14758845-14758867 TGTCCCGCAGACTGCAGTGCAGG - Intronic
1166376274 19:42328999-42329021 TGTGCTGCAGATAACAGAGCAGG + Intronic
1167162033 19:47774290-47774312 TGTGCTGAGGACATCAGTGAGGG + Intergenic
926093443 2:10065142-10065164 GGTGCTGAGGGCTGCAGTGCAGG - Intronic
929474213 2:42229396-42229418 GGTGCTTAAGAGCACAGTGCTGG - Intronic
929503945 2:42513702-42513724 TGTCCTGAAGCCCAGAGTGCTGG + Intronic
930840671 2:55841722-55841744 TGAGATGAAGATTCCAGTGCAGG + Intergenic
932771829 2:74504790-74504812 TATGCTGCAGCATACAGTGCGGG - Intergenic
932956491 2:76357181-76357203 TGTGCAGAAGACAACAGTTGAGG + Intergenic
933350145 2:81143856-81143878 AGGGCTGAAGACTTCAGTGGAGG + Intergenic
937051115 2:118891383-118891405 TGTGCTGAAGTCTACAATGCTGG + Intergenic
937166526 2:119823676-119823698 TTTGCTGAAGATTTCAGTGGTGG + Intronic
938201733 2:129377896-129377918 TGTGCTGGAGACTATAGTTAAGG + Intergenic
938219506 2:129553453-129553475 TGTGGTTAAGACTGCAGTTCTGG - Intergenic
947624498 2:231611395-231611417 TGTGATGACGAATAAAGTGCGGG + Intergenic
948696434 2:239735298-239735320 TGTCCTGGAGCCTCCAGTGCCGG + Intergenic
1170705745 20:18743353-18743375 TTTGCTGAAGATTACAGAGAAGG - Intronic
1172398054 20:34623804-34623826 TTTGCTCAAGGCTACAGAGCTGG + Intronic
1175391438 20:58630060-58630082 TTTCCTGAAGACTCCAGTGTGGG + Intergenic
1177737497 21:25109893-25109915 TGTTCTGAAAAATACGGTGCAGG - Intergenic
1180247470 21:46557781-46557803 TGTGCTGCAGACCACAGCCCTGG + Intronic
1181105860 22:20574833-20574855 TGTGTTGAGGACACCAGTGCAGG + Intronic
1181996258 22:26885235-26885257 TGTGATGAAGACTTCAGCCCTGG - Intergenic
950502320 3:13372351-13372373 TGTGCTGAAGTGCACTGTGCAGG + Intronic
951978279 3:28538773-28538795 AGTGTTGAAGACCATAGTGCAGG - Intergenic
952556956 3:34542548-34542570 TTTGATGAAGATTACAATGCAGG - Intergenic
958930839 3:100206248-100206270 GAAGCTGAAGACCACAGTGCAGG + Intergenic
959589301 3:108059967-108059989 TGTGGAGAAGAATGCAGTGCAGG - Intronic
960976819 3:123183935-123183957 TGTGCTGAAGAATATAGGCCCGG + Intronic
963258286 3:143168613-143168635 TGAGCTAAAGATCACAGTGCTGG - Intergenic
964568566 3:158087550-158087572 GGGGCTGAAGACTTCAGTGGAGG - Intergenic
968486103 4:863168-863190 GGAGTTGAAGACTTCAGTGCAGG + Intronic
968539584 4:1157803-1157825 GGAGTTGAAGACTTCAGTGCAGG - Intergenic
968680963 4:1919290-1919312 TGTTCTGAAGCTTCCAGTGCAGG + Intronic
968770772 4:2505131-2505153 TGTGGTGAAGACAGCAGTTCTGG - Intronic
969371161 4:6732543-6732565 TCTGCTTAAGCCTAAAGTGCTGG + Intergenic
972871415 4:43304429-43304451 AGAGCTGAAAACTCCAGTGCTGG - Intergenic
973197739 4:47464471-47464493 GGTGCTGAAGAATTCAGTGGTGG + Intergenic
976247506 4:83018460-83018482 TGTGCTAATTACTACAGTACTGG + Intergenic
982115421 4:152094879-152094901 TGTGCTGAGGACTATTCTGCAGG + Intergenic
982148072 4:152420345-152420367 AGGGCTCAAGACTACAGTGGAGG - Intronic
982326239 4:154131272-154131294 TGTGAAGAAGACAACATTGCGGG + Intergenic
982471919 4:155802672-155802694 TGTACTCAAGGCTGCAGTGCTGG - Intronic
983907705 4:173202020-173202042 TTTGCTTAAGACAACTGTGCTGG + Intronic
984205497 4:176783017-176783039 TGTGCTGAAGACTACAGTGCTGG - Intronic
984647960 4:182240070-182240092 TTTGCTGATGACTGCAGTGGGGG + Intronic
987264763 5:16241679-16241701 TGGGAAGAAGACTACAGTGAAGG + Intergenic
990467075 5:56080509-56080531 TTTCCTGAAGCCTACACTGCAGG - Intergenic
991490251 5:67175838-67175860 AGTGCTAATGACTCCAGTGCAGG - Intergenic
995833722 5:116380210-116380232 TGGGCTGAAGACTTCAGCACAGG + Intronic
997521356 5:134526224-134526246 TGTTTTAAAGAGTACAGTGCGGG + Exonic
997817504 5:137033224-137033246 TGTGCTGCAGCCTGCAGTGTGGG + Intronic
998841754 5:146261651-146261673 TGTGCTGAGGACTGTAGTGTCGG - Exonic
1001741874 5:174059802-174059824 TATGCTGAAGACTTTAGTCCTGG - Intronic
1003722570 6:8720418-8720440 TGTCCTGATGCCTACAGTGCAGG + Intergenic
1022917729 7:34976275-34976297 TGGGCTCAAGACTTCAGTGGAGG + Intronic
1022952759 7:35354285-35354307 TGTGCTTAAGGTTACACTGCTGG + Intergenic
1024569565 7:50712736-50712758 TGTGCTGAACACTGCAGAGTGGG - Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1027633471 7:80638635-80638657 TGTACTGAGGACTGCAGTGTAGG + Intronic
1027981027 7:85222676-85222698 TCTGCTAAAGACTGAAGTGCAGG - Intergenic
1029312482 7:99679987-99680009 TTGGCTGAAGACTGCTGTGCAGG - Exonic
1029497394 7:100903418-100903440 TGTGCTGCAGGCAACAGTGATGG + Intergenic
1032072464 7:128816873-128816895 AGTGCTGAAGACCAAATTGCTGG - Intronic
1033143002 7:138844434-138844456 TTTGCTGCAGTCTACAGAGCTGG - Exonic
1035200414 7:157260510-157260532 TGTGCTGGGGACTAAAGAGCAGG + Intronic
1038396107 8:27246764-27246786 TCTGCTGAAGACTCCAGGGGAGG - Intronic
1038455065 8:27667564-27667586 CGTGCTCAAGATAACAGTGCTGG - Intronic
1041352983 8:56967665-56967687 TGTTCTCAAGACTACAATTCTGG - Intronic
1041857153 8:62470596-62470618 TGTGATGAACACTGCAATGCAGG - Intronic
1042027732 8:64442034-64442056 TGTCCTGCAGATTCCAGTGCAGG + Intergenic
1043079385 8:75746576-75746598 TCTGCTGCAGACTTCAGTTCTGG - Intergenic
1044787802 8:95814019-95814041 TGTGGTGAACATTACACTGCTGG - Intergenic
1047408897 8:124608212-124608234 TGTGGGGAAGAAAACAGTGCAGG - Intronic
1047801160 8:128311810-128311832 TATGCTAAAGGCTACAGTGAAGG + Intergenic
1048472265 8:134713747-134713769 TGAGCCGAGGACTACAGTGTTGG - Intergenic
1052240418 9:26265572-26265594 TGTTCAGATAACTACAGTGCTGG + Intergenic
1054954412 9:70891856-70891878 TTTGCTGAAGACCTCAGGGCTGG + Intronic
1057291092 9:93807919-93807941 TGTGCTGGAGGCTCCAGGGCTGG + Intergenic
1059833820 9:118128359-118128381 TGTGCTGCAGCCACCAGTGCAGG + Intergenic
1060661392 9:125407373-125407395 TGTGCAGATGACAACAGTGAGGG - Intergenic
1061517415 9:131097755-131097777 TTTGCTGAGGACCACAGAGCTGG - Intronic
1197399717 X:125974923-125974945 TGTGGTGAAGACTACCTGGCTGG - Intergenic