ID: 984205497

View in Genome Browser
Species Human (GRCh38)
Location 4:176783017-176783039
Sequence TGTGCTGAAGACTACAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984205497_984205501 8 Left 984205497 4:176783017-176783039 CCAGCACTGTAGTCTTCAGCACA 0: 1
1: 0
2: 1
3: 5
4: 140
Right 984205501 4:176783048-176783070 ACGCAAGTCACAGCACTGACTGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984205497 Original CRISPR TGTGCTGAAGACTACAGTGC TGG (reversed) Intronic