ID: 984213527

View in Genome Browser
Species Human (GRCh38)
Location 4:176879830-176879852
Sequence ATTAATAAGCTAATGCTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984213527_984213532 30 Left 984213527 4:176879830-176879852 CCTATTAGCATTAGCTTATTAAT No data
Right 984213532 4:176879883-176879905 ATTAACTATCCCATTTTATTAGG No data
984213527_984213528 -1 Left 984213527 4:176879830-176879852 CCTATTAGCATTAGCTTATTAAT No data
Right 984213528 4:176879852-176879874 TCCCACACAGCATCTTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984213527 Original CRISPR ATTAATAAGCTAATGCTAAT AGG (reversed) Intergenic
No off target data available for this crispr