ID: 984213528

View in Genome Browser
Species Human (GRCh38)
Location 4:176879852-176879874
Sequence TCCCACACAGCATCTTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984213526_984213528 26 Left 984213526 4:176879803-176879825 CCTTACTTAGGGAAATATCTGTT No data
Right 984213528 4:176879852-176879874 TCCCACACAGCATCTTTCCAAGG No data
984213527_984213528 -1 Left 984213527 4:176879830-176879852 CCTATTAGCATTAGCTTATTAAT No data
Right 984213528 4:176879852-176879874 TCCCACACAGCATCTTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984213528 Original CRISPR TCCCACACAGCATCTTTCCA AGG Intergenic
No off target data available for this crispr