ID: 984213532

View in Genome Browser
Species Human (GRCh38)
Location 4:176879883-176879905
Sequence ATTAACTATCCCATTTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984213530_984213532 6 Left 984213530 4:176879854-176879876 CCACACAGCATCTTTCCAAGGTA No data
Right 984213532 4:176879883-176879905 ATTAACTATCCCATTTTATTAGG No data
984213527_984213532 30 Left 984213527 4:176879830-176879852 CCTATTAGCATTAGCTTATTAAT No data
Right 984213532 4:176879883-176879905 ATTAACTATCCCATTTTATTAGG No data
984213531_984213532 -9 Left 984213531 4:176879869-176879891 CCAAGGTAAATACTATTAACTAT No data
Right 984213532 4:176879883-176879905 ATTAACTATCCCATTTTATTAGG No data
984213529_984213532 7 Left 984213529 4:176879853-176879875 CCCACACAGCATCTTTCCAAGGT No data
Right 984213532 4:176879883-176879905 ATTAACTATCCCATTTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984213532 Original CRISPR ATTAACTATCCCATTTTATT AGG Intergenic
No off target data available for this crispr