ID: 984216383

View in Genome Browser
Species Human (GRCh38)
Location 4:176917326-176917348
Sequence AGGGGAAGAAACTTAGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984216375_984216383 5 Left 984216375 4:176917298-176917320 CCAGGGCCTGTTTGGGGGTCAGC No data
Right 984216383 4:176917326-176917348 AGGGGAAGAAACTTAGAGGACGG No data
984216378_984216383 -1 Left 984216378 4:176917304-176917326 CCTGTTTGGGGGTCAGCGGGTGA No data
Right 984216383 4:176917326-176917348 AGGGGAAGAAACTTAGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984216383 Original CRISPR AGGGGAAGAAACTTAGAGGA CGG Intergenic
No off target data available for this crispr