ID: 984217318

View in Genome Browser
Species Human (GRCh38)
Location 4:176930630-176930652
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984217311_984217318 27 Left 984217311 4:176930580-176930602 CCAGTATGAATTAAGGGGTAAAA No data
Right 984217318 4:176930630-176930652 CAGTGTTGGGGGAAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr